Разное2110 ремонт порогов: 2110, 2111, 2112 | , , ,

2110 ремонт порогов: 2110, 2111, 2112 | , , ,

Содержание

Особенности ремонта автомобильных порогов: что важно знать

К сожалению, наши горячо любимые транспортные средства являются очень даже уязвимыми. В частности это касается порогов, которые подвержены различным негативным влияниям природы – холоду и жаре, яркому солнцу и влажности. Рано или поздно на днище могут появляться первые признаки коррозии, которые в большей степени затрагивают пороги транспортного средства.

Коррозия порогов 2110

Но коррозия – это далеко не единственное зло для днища и порогов. Нельзя забывать и о возможных механических и вибрационных воздействиях. В частности, очень часто автолюбители деформируют пороги в процессе использования того же домкрата. Могут быть различные удары о препятствия и во время передвижения. Таким образом, в большинстве случаев просто необходимой является вытяжка, рихтовка или правка деформированных участков. Практика показывает, что если своевременно выполнять работы по восстановлению порогов, то можно быть уверенным, что кузов автомобиля прослужит очень долго.

Виды порогов

Для лучшего понимания стоит выделить два вида порогов – несъемные и съемные. Первый тип приваривается непосредственно к кузову. При этом несъемные пороги в комплексе с дном автомобиля формирует весь его низ. Что касается съемных порогов, то они устанавливаются непосредственно в салоне машины. При этом крепить их необходимо при помощи обычных винтов (непосредственно к кузову). Назначение подобной конструкции понятно – защита от камней, грязи и прочего мусора, который может вылетать из-под колес.

Любой ремонт порогов не обойдется без целого набора необходимых инструментов. В частности, для выполнения работ стоит подготовить опорную плиту, сварку, не лишними будут также инструменты рихтовщика и верстак. Если есть пневмозубило или же болгарка, то это только плюс.

Быстрый ремонт

Если необходимо отремонтировать пороги съемного типа, необходимо учитывать, что делать это гораздо удобнее. В большинстве случаев достаточно просто выкрутить винты и снять порог. Ремонт деформированного изделия необходимо выполнять исключительно на верстаке. При этом для выполнения более точных работ необходимо использовать рихтовочные инструменты. Если повреждения имеют более серьезный характер, к примеру, есть сквозные дыры, то пороги лучше заменить. При этом внутренняя поверхность должна покрываться специальным составом, защищающим от коррозии.

Как ремонтировать приваренные пороги

Такие работы могут иметь различную сложность, в зависимости от вида и тяжести повреждения. Если же пороги не имеют больших складок, то процесс выправления можно производить с наружной стороны. С помощью специального инерционного споттера может производиться последовательная вытяжка. При этом заблаговременно должны быть приварены специальные скобы.

Если повреждение носит достаточно серьезный характер, то снять зону ремонта все-таки придется. В частности, желательно демонтировать сиденья и двери и убрать напольное покрытие.

Если же имеют место серьезные повреждения, то дефектную часть необходимо обязательно удалить.

Для реализации такой задачи не обойтись без пневматического зубила или же болгарки.

В ситуациях, когда поврежден не только порог, но и стойки, то ремонтировать данные изделия желательно одновременно.

Выпрямительный блок 21102, 2110. Проверка работы выпрямительного блока Кузов ВАЗ 2110, 21102. Детали кузова

Цены на кузовные работы автомобиля LADA 2110

Главная » Цены на ремонт авто » Lada » Кузовной ремонт LADA 2110

Вы повредили кузов Вашего автомобиля и внешний вид транспортного средства оставляет желать лучшего. Повреждения кузова могут быть незначительными (вроде царапины), так и серьезными (после ДТП). В любом случае кузов нужно привести в порядок не только с целью возвращения эстетического вида, но и ради базового уровня безопасности.

Обратитесь к профессионалам! Это станет первым шагом к тому, чтобы Ваша Лада 2110 снова блестела и дарила наслаждение не только от скоростной и безопасной езды, но и от созерцания красоты Вашего автомобиля.

Цены на замену, снятие и установку элементов кузова для LADA 2110:

Капот замена (снятие и установка) 1 000 РУБ
Крыло переднее левое или правое замена (снятие и установка) 800 руб
Дверь передняя правая или левая замена
(снятие и установка)
1 520 РУБ
Дверь задняя правая или левая замена (снятие и установка) 1 200 руб
Бампер передний или задний замена (снятие и установка) 800 руб
Крышка багажника замена (снятие и установка) 1 500 руб

Цены на замену несущих элементов кузова для LADA 2110
Крыша авто  — замена от 9 000 руб
Крыло  заднее правое или левое — замена от 8 600 руб
Лонжерон задний или передний — замена от 8 000 руб
Порог правый или левый — замена от 5 000 руб
Стойка двери автомобиля — замена от 6 500 руб

Стапельные работы на LADA 2110:
Установка на стапель с замером базовых точек для проверки, а так же и для восстановления геометрии кузова 2 000 руб

Почему стоит доверять лишь специалистам?

1. Кузовной ремонт требует опыта, которым обладают только профи. Здесь недостаточно знаний технических особенностей систем автомобиля или банальной замены запчасти. В этом случае нужны реальные навыки, практический опыт, поскольку испортить вид кузова можно значительно легче, чем кажется. Только руки профессионалов сервиса будут гарантией качественного кузовного ремонта Вашего LADA 2110.

2. Только настоящие профи могут взяться за кузовной ремонт после очень тяжелых ДТП, когда нужно осуществлять замену большого количества частей и выравнивать чрезвычайно сложные вмятины. Там, где дилетанты сразу откажут в ремонте или укажут заоблачную цену за свою работу, специалисты профессионального сервиса готовы предложить умеренные цены даже на сложные типы ремонта, учитывая стапельные работы.

За более подробной информацией обращайтесь по телефонам в Нижнем Новгороде


8 (831) 291-26-20, 8 (920) 297-19-03

Оставьте заявку на ремонт прямо сейчас

Ремонт порогов автомобиля без сварки

Обратился в сервис после неприятного ДТП, в котором  повреждена левая передняя часть автомобиля, под замену л. крыло, л.фара, бампер на перекрас и восстановление , капот  замят, но при оценке работ Мастера сказали, что капот восстановят. Так-же видны некоторые недочеты по задней двери и крылу. В итоге…

Обратилась в Веб-автосервис, из за поврежденного крыла и бампера. Ребята справились с работой безупречно и цвет краски подобрали идеально! Выполнили в кратчайшие сроки, даже раньше чем было оговорено, благодарю от всей души!!!

Шевроле Круз, попал в ДТП (ударил грузовик на трассе). Страховая по ОСАГО написала замену заднего крыла, бампера и т. д. Обращался в два сервиса — сказали то же самое. Если кто не в курсе, заднее крыло как деталь не существует — надо вырезать из другого кузова часть, сваривать, красить и т. д. Написал…

Спасибо вам огромное! Вы супер!!! 🙂 И вы – профессионалы. Профессионалы – это когда можно к вам приехать и вы  сделаете работу правильно, не взяв больше денег, чем нужно. Муж перестал бояться, что меня обмануть могут, спокойно отпускает к вам.

Радует, что к вам можно приехать и масло поменять, и колёса,…

Обратился для окраски бампера. Нужно сделать очень быстро. Сделали за 1 день (утром машину оставил, вечером забрал). Работа выполнена качественно и за приемлемую цену. Спасибо мастерам. Отдельная благодарность директору Еве за отзывчивость и профессионализм. Дали гарантию на выполненные работы. Смело…

С Вебавтосервисом давно уже. Сначала обратился за ремонтом двери. Затем на техобслуживание приезжал. Можно сказать, подружились уже за несколько моих визитов.)) Хорошо, что от дома недалеко, хотя сейчас понимаю, что приезжал бы к вам даже с области. Ну, нравится мне у вас, что поделать!!! Хотя самое…

Ваш постоянный клиент Лариков Владимир

Обращались в Веб-автосервис неоднократно. Последний раз для перетяжки салона авто. Ребята как всегда справились с задачей отлично. Помогли подобрать износоустойчивый и недорогой материал. Выполнили работы оперативно и без малейших изъянов. Огромное спасибо!

Смирнова Ольга на Mazda 3

Большое спасибо за идеальную покраску авто. Очень довольна доброжелательным отношением к клиентам и щепетильным выполнением всех работ. Мастера в этом автосервисе просто замечательные. Они сумели вернуть былой блеск моей Мазде. Долго ожидать не пришлось. Работы выполнены оперативно, а за рихтовку мелких…

Попал на своем Ford Focus в небольшое ДТП. Требовалась замена некоторых деталей, рихтовка и покраска. Обратился по поводу ремонта в Веб-Автосервис. Мастера справились с задачами отлично. Сумели подобрать краску в тон заводской. После ремонта машина выглядит идеально, как будто только что сошла с конвейера.…

Обратился с ремонтом и покраской двух дверей. Выполнили работы быстро и качественно!!! Забрал машину даже раньше чем договаривались. Спасибо!!!

Обратился с ремонтом и покраской двух дверей. Выполнили работы быстро и качественно!!! Забрал машину даже раньше чем договаривались. Спасибо!!!

Так, не знаю, куда отзыв писать, поэтому шлю на почту. Уже и не вспомню, почему именно к вам обратился и что подкупило. Всё-таки уже больше года прошло. Но могу точно сказать, что не жалею. Вы же помните, какая у меня дверь  после аварии – вся погнутая, краска ободрана. Смотреть страшно. Ну а вы сделали…

Страховщики при оценке повреждений моей машины (Опель Астра) сразу предупредили, что компенсации по ОСАГО, которую мне выплатят, на ремонт вряд ли хватит, так как машине, хотя она и в хорошем состоянии, 7 лет, и высчитанный ими износ составляет около 50%. А ремонт предстоял достаточно сложный – сильные…

В октябре 2019 года обратился в сервис с полной покраской машины AUDI A6 2008 года выпуска. Авто не битое, без аварий, но за 11 лет появились сколы краски на арках, царапины на бамперах, рыжие пятна на дверях и крышке багажника. Делал для себя, машина в возрасте, но расставаться жалко, решил обновить…

Остались очень довольны работой, не дорого по сравнению с конкурентами, цена не изменилась от ранее оговоренной, качественно. Сроки тоже в порядке. Обязательно обратимся ещё.

25.09.2019 отдал Форд-Мондео в ремонт. Довольно хорошо примяли переднюю дверь и крыло на парковке. Сделали на удивление быстро и качественно. Понравилась адекватная цена и чёткое выполнение обязательств. С проблемами-сюда. Отдельное спасибо мастеру Дмитрию.

Отдавал автомобиль на покраску. Великолепный результат! Приемлемая цена. Отличные специалисты.

Велина Лукьянова

Появление коррозии на задних арках машины заставило заняться поисками надежного СТО. Друзья посоветовали Веб-автосервис. Отдала свой форд мастерам вашего СТО, чтобы устранили проблему. Они великолепно справились! От ржавчины не осталось и следа. Сделано настолько качественно и аккуратно, что машина выглядит…

Озверевшая погода оставила довольно видимые следы на моем авто. Вмятины на крыше Opel vectra неслабые. Пришлось заказать кузовной ремонт в ближайшем СТО — это оказался ваш центр. Итогом сотрудничества остался доволен. Работа выполнена в срок. Ни малейшей неровности на поверхности крыши и идеальный подбор…

Покрасили порог. Были ржавые сколы от каблуков. Утром привез, вечером забрал машину. Покрасили идеально! На уровне заводского качества. Отличная работа!

Повредил кузов в ДТП, не глобально, но пришлось ехать исправлять. Сервис этот выбрал случайно, но качество понравилось. Работают толковые, опытные парни. Сроки не тянули, вернули авто как договаривались. Благодарю.

Записывалась на ремонт по телефону, в назначенное время машину приняли. Мастерская понравилась,  довольно чисто, мусор не валяется, как в некоторых бывает. Цену оговорили заранее и по итогу не отличалась, за это спасибо. Порекомендовала бы знакомым.

Сделали полировку кузова, теперь не видать царапин. Защитный слой отлично работает, спустя 3 месяца так же классно выглядит. Сервис хороший, буду заезжать по необходимости еще.

Нашёл этот сервис в интернете случайно. Почитал отзывы — понравилось.  Мне надо было отремонтировать заднюю дверь и поменять пороги на своём Мицубиши.  Сделали качественно и даже раньше, чем обещали. Лишних денег не берут и предлагают оптимальные для клиента варианты ремонта. Это дорогого стоит. Спасибо…

В «Веб-Автосервис» я отдавал на покраску свою мазду 3. Восстановили бампер (обнаружили вмятины и сколы, еще заменили усилитель бампера). На все работы ушло всего дней десять. И цена меня устроила, по сравнению с другими сервисами. Буду советовать друзьям!

Хочется сказать большое спасибо за качественный ремонт бампера на моей хонде акконд. Обнаружился скол, растрескалась краска от удара. После ремонта автомобиль буквально как новый, попадание в цвет стопроцентное! Ребята молодцы!

Месяц назад я отдавал автомобильна покраску переднего и заднего бампера, 4х крыльев и кузова. Цвет черный, выцветший и поцарапанный, сколы на бампере. Плюс заказал полировку кузова. Сомневался, так как  первый раз обращался в этот салон. Но когда увидел авто – не думал, что он может так блестеть! Яркий,…

Долго искал нормальный, вменяемый сервис, надо  поправить вмятину на крыше и капоте после падения снега. В разных побывал, либо очень дорого аж до сотни доходило, либо совсем дёшево, что не вызывает доверия и попахивает разводом! Попал случайно, отправил фото по вотсап, озвучили примерную стоимость,…

Обратился в сервис с вмятиной на крышке багажника и с повреждением пластиковой накладки на крышке багажника. Сначала отправил фото по вотсап, мне озвучили примерную стоимость, вечером уже приехал в сервис и оставил авто на ремонт. Обговаривали срок 4-5 дней, на третий день позвонили и сказали что машину…

Сделали оперативно, стапельные работы и качество покраски на уровне завода! Дмитрию огромное спасибо за помощь

Искал в интернете автосервис не далеко от дома для ремонта переднего крыла на авто. Встретился сайт ВЕБ-АВТОСЕРВИС, ул.Верейская д 29 стр 35, решил позвонить, по телефону общался с Дмитрием, обрисовал повреждения на моем авто, переслал по вацапу фото, Дмитрий озвучил ориентировочно цену, 18. 03.19…

Ситников Игорь

Попал случайно…Нужно недорого покрасить капот и два крыла Тойота Превия. Снаружи очень невзрачненько, НО приятно удивлен современным оборудованием в том числе покрасочной камерой. Общался с Дмитрием — обговорили цены, запчасти, сроки, которые тоже порадовали… Кроме этого, что очень удивило, не пробовали…

Владимир Григорьевич

Приняли машину, оценили масштаб работ, сделали. Быстро и без нареканий. Рекомендую!

Спасибо мастеру, быстро и качественно сделали. Желаю процветания.

Оставлял машину для ремонта после аварии. Сделали точно как хотел. Ремонт не вышел за рамки бюджета. Но важно что выполнили работы достаточно быстро. Покраска на уровне заводской. Рекомендую

Зиновьев Михаил

Квалифицированные работники, быстрый ремонт, недорого. Все гуд.

Хороший сервис, приветливые ребята, ничего не впаривают и не навязывают.

Быстро, качественно, по цене адекватно. Огромное спасибо за проделанную работу.

Приезжал сюда на замену крыла и бампера своей короллы. Проверял внимательно – машина как новенькая. Спасибо мастерам.

Очень быстро, качественно, дешево. На пятерку.

Спасибо приемщику Дмитрию и коллективу!!!Оставил машину 24го,забрал 26го. Покрас не отличается от заводского.Быстро и красиво.

Недавно ремонтировала в этом сервисе свою ласточку, сделали работу на высшем уровне. Я очень довольна, рекомендую! Хорошо подобрали цвет, качественные детали. Мастер доступно объяснил, показал в чем суть. Соотношение цены -качества хорошее.

Хочу поблагодарить Веб-автосервис за быстрое распознавание и устранение проблем с хорошими ценами.

Рекомендую. Удачи и процветания вашей команде.

Приятно удивили скорость и качество работы! Красили передний бампер на БМВ, выполнили в идеале и ценник проходной. Рекомендую.

Всем здравствуйте,никогда не писал отзывы , а тут решил поблагодарить данный автосервис, попал в ДТП , поскольку в связи со спецификой работы автомобиль нужен почти каждый день, первые критерии это сроки и цена.приехал в веб автосервис очень вежливо и грамотно приняли но самое главное что что все…

Спасибо сотрудникам сервиса. Очень быстро и профессионально покрасили крыло у моей машины. Довольна и рекомендую Веб-Автосервис.

Огромное спасибо работникам этого сервиса. Приятно доверить свой авто класcным специалистам своего дела.Окрашивали мне почти весь кузов(так получилось из-за множественного количества вмятин, царапин, сколов и т. д.). Короче говоря был доволен полученным результатом-за кротчайший срок,умеренным ценником,качественной…

Мы ремонтировали в этом сервисе капот машины, красили передний бампер и пару вмятин пришлось выравнивать. отремонтировали быстро и качественно! Мы остались очень довольны и работой и ценой. Спасибо вам, ребята! Так держать!

Сервис хороший , работу сделали быстро и качествено ! Цена приятно удивила , спасибо !!! Советую , делать в этом автосервисе ремонт !!!

Благодарю за проделанную работу. Качественно, быстро. Машинка как новая стала. Цены не кусаются. Спасибо большое

Хороший сервис, спасибо ребятам, сделали быстро и качественно, цены более чем приемлемые. Очень приветливая хозяйка, теперь если что случится, только к вам!

Быстрая, качественная работа, можно рекомендовать.

Сервис отличный. Мятое крыло на Шевроле Круз вытянули на отлично. Цвет от оригинала не отличить и сделали на день раньше чем договаривались.Всем друзьям буду рекомендовать.

Обратилась в сервис за услугами частичной покраски, царапин на дверце после неудачной парковки… Получилось в тон и цвет. Спасибо команде сервиса!!!

Огромная благодарность!!! Как всегда супер обслуживание. Вот единственное о чем я сейчас жалею, что не нашла этот сервис раньше Всего пару лет назад узнала о нем от своего друга, который очень рекомендовал не тратить напрасно время и деньги, а сразу обратиться именно сюда. Сэкономила бы кучу денег…

Спасибо, работникам этого сервиса. Работы по восстановлению кузова, были сделаны в кротчайшие сроки.Качество работ на высоком уровне.Работой сервиса остался доволен. С уверенностью, буду рекомендовать,эту компанию.

Ребятам огромное спасибо!!! Мой BMW после дтп находился в плачевном состоянии,настроение в г….. ! После ремонта следы аварии теперь не видны и сделали шикарно! Не видитесь на евроремонты и крутизну,в обычных сервисах делают тоже отлично. Персонал приветливый и знают своё дело!!! РЕКОМЕНДУЮ ЭТОТ СЕРВИС. 

Супер!!!!! Договорились о стоимости ремонта и сделали работы даже быстрее оговоренных сроков! Цены низкие,качество высокое и гарантия на год! Теперь только сюда!!! Не пожалеете!!!

Благодарен за быстрый и качественный ремонт. Ремонтировал машину именно в этом сервисе. Доволен порядком цен и уровнем обслуживания, дружный сплаченный коллектив.Сделано в срок и аккуратно. После ремонта в Авто не одной пылинки. За всё это время только положительные впечатления. Очень удобно записываться…

Обслуживание персонала приветливое и уважительное. Сроки соблюдают. Качество ремонта отличное. Замечаний по ремонту нет

Нашел этот автосервис через интернет. Связался по телефону, рассказал о повреждениях своего авто, мне озвучили приблизительную стоимость и сроки ремонта. Приехал, сдал машину в ремонт. Через 3 дня мне позвонил мастер и сказал, что моя машина готова. Оперативно и качественно! Спасибо огромное за качественную…

С радостью буду советовать этот автосервис друзьям! Мне здесь очень вовремя исправили вмятину на двери, без лишней траты времени, причем недорого. Спасибо опытным мастерам.

Сервис хороший. Помятый кузов восстановили отлично, и цвет ЛКП не изменился. Очень удобно то, что можно записаться на ремонт или диагностику прямо на сайте.

Посещала этот автосервис один раз, но сразу обратила внимание на внимательное, доброжелательное  отношение к клиенту. Не часто встретишь такое. Качество работ на высоком уровне, теперь записываюсь на ремонт только сюда.

Спасибо большое! Очень быстро и качественно сделали!!! Советую всем знакомым!

Делала перетяжку салона в этом сервисе, забрала будто другой автомобиль!!! Очень нравится!!! еще понравилось внимательное и доброжелательное отношение к клиентам! Теперь буду всем советовать данный автосервис.

Хороший сервис, исправляли вмятину на машине жены. Сделали быстро, качественно и по адекватной цене. Остались довольны обслуживанием. Спасибо

Дмитрий Григорьев

Ребята- мастера своего дела, сделали кузов быстро и недорого. цена-качество огонь.

Хочу сказать огромное спасибо мастерам. На моей машине теперь ни одной царапинки и скола. Очень порадовало качество работы! Теперь еще идеи появились внутри салон как-то изменить. Так что скоро снова приеду )

Отлично убрали вмятину на задней двери. Теперь знакомым РЕКОМЕНДУЮ только этот автосервис.

Приехала, оценили стоимость работы, взяла время подумать день-два. Если бы не моя мнительность, то на «новеньком» авто ездила бы гораздо раньше. ЗРЯ сомневалась, сделали ремонт по высшему разряду. РЕКОМЕНДУЮ .

Восстановили мой автомобиль после аварии. Ребята отработали на совесть. И по цене очень демократично вышло. Так что советую, если необходимость такая возникнет обратиться именно сюда.

Огромное спасибо. Так получилось, что уже 2 раза здесь ремонтировал автомобиль. Вытянули и покрасили отлично. Так что всем рекомендую!!!

Архипов Константин

Ремонтировал свой крузак в этом сервисе,отстучали крыло и оно как новое! У дилеров объявляли под замену… Поэтому вышло дешевле здесь и на качестве не отразилось. Когда становится нужен ремонт обращаюсь в веб-автосервис!!!

Добрый день! Машину сделали мне в срок и я довольна,как она выглядит сейчас. Через неделю планирую приехать полировать авто.Рекомендую этот сервис,у них скидки постоянным клиентам))

Сергей Александрович

Ребята молодцы, делают свою работу на высоком уровне.Часто проводятся скидки, акции, что особо радует 🙂  Рекомендую друзьям и близким.

Привез машину после дтп в этот сервис,забрал без следов аварии. Качество работ и материала высокое,работают ответственно в этом сервисе!

Приветствую,Вас! Забрала сегодня свой лексус и настроение супер!))) Отлично покрасили и отношение к клиентам хорошее,рекомендую.

Здравствуйте! Мне посоветовали этот сервис и я доволен,как отремонтировали мой авто!Красили правую сторону полностью и она как новая!!! Огромное спасибо ребятам этого сервиса!

Никаких нареканий, одни положительные впечатления. Рекомендую.

Олег, Луховицы

Выражаю огромную благодарность автосервису и лично руководителю Дмитрию и мастеру Алексею. Был неудачный опыт обращения в другой сервис, была плохо покрашена машина. Осталась ржавчина, цвет неровный не равномерный. Алексей выполнил работу отлично, классно выполнил покраску, в срок и качественно. Очень…

Виктор, Москва

Сосед сдавал задом и не заметил мою машину , задел мой авто. В веб автосервисе решили проблему быстро и недорого. Определить что ремонтировалось не получается, делают под ключ, экономя мое время с покупкой зап частей, а так же радует цена, вполне приемлема. Машину сделали очень достойно, придраться…

Сергей, Москва

В декабре прошлого года произошло неприятное ДТП, понадобился «кузовной». Почти перед новым годом кто-то ударил мою машину в переднюю часть, оторвав бампер, разбил фары. Ремонт в вебавтосервисе под ключ сделали за 3 дня, мастера Сергей и Алексей все подробно мне рассказали, не завышали стоимость,…

Ремонт по ФЕНШУЮ!) Сделали  работу целиком и очень быстро. Ребята приятные и очень веселые. Что несказанно удивило, ни шутки про обезьяну с гранатой или типа такой. Отношение как к обычному автовладельцу, а не как к блондинке. Описали подробно мою проблему, предложили решение. Объясняли, проявляли…

Замена порогов на ВАЗ 2110 в Смоленске :: Автоцентр «NRG»

Ремонт и замена порогов автомобиля ВАЗ 2110

Интересует замена порогов на ВАЗ 2110? Не хотите тратить время на поездки в гараж и самостоятельное решение проблемы? Обратившись в наш автоцентр, вы сможете легко справиться с актуальным вопросом. Опытные специалисты быстро и профессионально выполнят работу, установив на нее приемлемую для вас стоимость.

Все, что требуется – это осудить с мастерами дату и время, на которые вы хотели бы запланировать замену порогов на ВАЗ 2110. Также уточните, нужны ли дополнительные услуги, к примеру, покраска новых обвесов. После детализации предстоящих работ наши специалисты смогут назвать точную их стоимость. И вне зависимости от того, какой сложности и объемов задачу вы поставили перед ними, цена вопроса будет оставаться максимально демократичной.

Мы проявляем заботу о своих клиентах, поэтому стараемся предоставлять выгодные и качественные услуги. Вы убедитесь в этом лично, отметив, что ни в одной мастерской Смоленска не выполняют замену порогов на ВАЗ 2110 на столь доступных условиях.

Почему не стоит менять пороги на ВАЗ 2110 самому

Вы можете решить задачу и самостоятельно, выполнив предстоящие работы своими руками. Но, они отнимут много свободного времени и сил, могут усложниться непредвиденными моментами, особенно, если до этого вы никогда не сталкивались с подобной необходимостью. Проще всего воспользоваться помощью профессионалов. Так вы сэкономите и время, и нервы, и силы. К тому же, цена замены порогов на ВАЗ 2110, установленная автоцентром NRG, самая доступная в Смоленске.

Мы заботимся о своих клиентах, понимаем, насколько дорого может обходиться содержание автомобиля, даже если это транспорт отечественного производства. Именно поэтому главная цель автоцентра – сделать предлагаемые услуги приемлемыми для водителей. И на данный момент мы смогли ее успешно достичь.


Остались вопросы?

Замена порогов ВАЗ 2110: как заменить пороги самому

19.07.2021

Реклама наших партнеров

Пороги на многих автомобилях отечественного производства являются достаточно слабым местом. По этой причине замена порогов ВАЗ 2110 могла потребоваться уже через 5-6 лет эксплуатации применительно к новым авто.

Для замены порогов на ВАЗ 2110 необходимо:

  • подготовить сварочный и абразивный инструмент, приобрести новые короба;
  • выполнить частичный разбор автомобиля (снять двери и крылья) для демонтажа старых порогов;
  • после установки новых порогов осуществить шпаклевочные и покрасочные работы;
  • параллельно новые пороги рекомендуется дополнительно защитить от коррозии.

В целом, объем работ достаточно большой. Также потребуются определенные навыки и инструменты. Однако все операции можно выполнить своими руками в условиях обычного гаража. Подробнее читайте в нашей статье.

 

Подготовка автомобиля

Для замены порогов машину нужно подготовить, выполнив частичную разборку. Для этого потребуется:

  • Установить машину на ровную площадку (важно не допускать перекосов кузова).
  • Снять локер, передние и задние двери, водительское сиденье, пассажирское сиденье, крылья, ремни безопасности, убрать с пола шумоизоляцию.
  • Стекла автомобиля следует накрыть ветошью или картонными шторками для защиты от искр и летящих окалин.
  • Все элементы, которые могут загореться или расплавиться в рабочих зонах, также следует защитить или снять;
  • Отключить АКБ, чтобы случайно не оказать влияние на батарею и электропроводку автомобиля.

На этом подготовку машины к замене порогов можно считать завершенной.

 

Пороги на ВАЗ 2110: какие выбрать

Существует несколько вариантов подбора порогов на ВАЗ. Можно приобрести пороги б/у, снятые с другого автомобиля, так называемые «кооперативные» элементы (бывают разного качества), а также оригинальные пороги 2110.

При должной обработке и защите от коррозии заводские пороги на 2110 могут прослужить не менее 8-10 и более лет в условиях активной эксплуатации. Каталожный номер порогов: правый порог на ВАЗ 2110 — 21100540106000, левый порог 21100540106100.

На практике, оптимальным вариантом является оригинальный порог ВАЗ 2110, так как сложности с установкой сведены к минимуму (в комплекте идут новые пороги, усилители и соединители ВАЗ 2110).

Если использовать другие детали, часто бывает так, что «кооперативный» элемент (не оригинальные пороги на ВАЗ 2110) плохо стыкуется с кузовом, требуются доработки и подгонка. Также металл подобных изделий нередко сомнительного качества. Результат — пороги сгнивают через 2-3 года.   

 

Какие инструменты и материалы понадобятся

Прежде всего, для замены порогов необходимо иметь сварочный аппарат. Лучшим вариантом будет полуавтомат. Также нужна болгарка и несколько дисков, металлическая щетка для болгарки с жесткой щетиной;

Еще потребуется иметь шлифовальный инструмент, электродрель, слесарный инструмент. Параллельно нужна упаковка автомобильной мастики, пара малярных кисточек, грунтовка и растворитель.

 

Замена порогов 2110

На модели ВАЗ 2110 замена порогов не отличается особой сложностью, однако процесс трудоемкий и предполагает наличие определенных профессиональных навыков работы и обращения с инструментами и материалами (сварочный аппарат, болгарка, дрель, шпатлевка, грунтовка и т.д.).

  1. Для начала необходимо наметить линии срезов старых порогов, высверлив по таким линиям отверстия диаметром от 4 мм на расстоянии не более 8 см от одного отверстия до другого.
  2. Далее болгаркой срезается старый порог, другие части, поврежденные коррозией, пороговый соединитель в верхней и нижней части порога.
  3. Обратите внимание, срезая наружную панель порогов, нужно оставить часть металла (не мене 5 см) возле переднего, а также заднего крыла. Причина — к этим участкам металла будет при помощи сварки крепиться новая панель. Еще нужно оставить часть металла в области средней стойки (под стойкой).
  4. В рамках ремонта следует зачистить поверхность корщеткой в том месте, где будет стоять новый порог, а также обработать поверхность (потребуется преобразователь ржавчины).
  5. Закончив подготовку, нужно навесить двери, чтобы точно и правильно приварить новый порог.
  6. Установив элемент, порог можно шпатлевать, грунтовать и красить. Также настоятельно рекомендуется обработать пороги антикоррозийными составами и защитить антигравием или воспользоваться другим способом защиты порогов.

В целом, меняя пороги ВАЗ 2110, нужно обратить внимание на следующие моменты:

Перед вырезанием порога нужно внимательно осмотреть все участки. Если есть места, которые можно отрихтовать, прогрнутовать и покрасить, лучше такие участки не вырезать. Остальные проржавевшие части или пороги целиком срезаются болгаркой строго по линиям с высверленными отверстиями.

  • Обратите внимание, первыми пороги режутся в области передних дверей, далее в области задних, а уже затем часть в области средней стойки.
  • После среза порогов металлической щеткой на болгарке следует удалить остатки ржавчины и грязи по краю среза. Другие мелкие ржавые участки также нужно вырезать.
  • В тех местах, где будет осуществляться сварка, зачистка должна быть выполнена наилучшим образом.
  • Перед тем, как установить на ВАЗ 2110 пороги, их нужно обработать антикором, специальным грунтом и т.д. Параллельно обрабатывается и усилитель порога.
  • При монтаже новый усилитель порога к усилителю подрамника обычно приваривают внахлест, а нижние края ровняют.
  • Важно подогнать наружную панель к соединителю максимально точно. Если подогнать не получается, можно расширить выемку. Точно размещенная панель крепится при помощи струбцин.
  • Далее соединитель приваривают к днищу, после чего приваривают и верхнюю часть порога (не ослабляя струбцин).
  • Сварные швы требуется качественно зачистить, затем зашпатлевать и проверить их на предмет полной герметичности. После потребуется их прогрунтовать и качественно прокрасить.

 

Рекомендации

Как правило, на многих автомобилях пороги разрушаются по причине коррозии. На порогах скапливаются дорожные реагенты и соли, часто они находятся в грязи, в скрытых полостях собирается влага и конденсат.

Также механические повреждения, царапины, вмятины приводят к повреждениям ЛКП и скрытой подпленочной коррозии. Можно добавить, что пороги на ВАЗ 2110 не отличаются особой стойкостью к коррозии и по причине не самого лучшего металла.

По этой причине лучше изначально уделить внимание порогам в процессе эксплуатации авто, чем менять порог 2110, поврежденный коррозией. Сегодня существует целый ряд методов и способов, позволяющих защитить пороги автомобиля от ржавчины и повреждений.

Еще добавим, что, если пороги нужно заменить самостоятельно, варить полуавтоматом намного проще, чем использовать другие методы сварки. При этом покупать такой аппарат не следует. Можно взять полуавтомат в аренду на определенный срок.

После замены порогов и окрашивания рекомендуется выполнить оклейку порогов специальной бронепленкой.   Это позволит защитить порог снаружи от царапин и пескоструя. Также порог в местах оклейки пленкой не меняет свой цвет и внешний вид, что является преимуществом по сравнению с традиционным решением обработать пороги ВАЗ специальными антигравиями.

 

 

Источник: krutimotor.ru

Реклама наших партнеров

Акционные товары

Ремонт порогов автомобиля в Москве в автосервисе «АвтоАнт»


Комментариев: нет

Рейтинг:

Метки:Вмятины на автоЗамена порогов

Среди всех комплектующих автомобиля пороги, безусловно, относятся к категории наиболее подверженных всевозможным повреждениям. Учитывая состояние современных российских дорог, вмятины на автомобильных порогах, к сожалению, являются довольно частым явлением.

Очень часто даже небольшие повреждения порога автомобиля нарушают структуру его покрытия и способствуют быстрому распространению ржавчины. Потому, если порог вашего транспортного средства поврежден, вытягивание или выравнивание необходимо произвести как можно быстрее.

Многие автомобилисты полагают, что подобного рода работы могут быть произведены лишь в специализированной мастерской, однако это не так — вытянуть вмятину на пороге автомобиля по силам почти каждому.

Удаляем вмятину на пороге

Разновидности автомобильных порогов

Перед тем как приступить к ремонту порога, вам нужно четко понять, с чем вы столкнулись, и какой способ выравнивания вам нужно будет использовать. Это напрямую зависит от разновидности детали, установленной на ваш автомобиль. Все автомобильные пороги можно разделить на две основные категории:

  • Съемные. Такую деталь можно легко снять в любой момент, потому как он крепится к кузову и днищу при помощи обыкновенных болтов.
  • Литые. Они привариваются к кузову транспортного средства еще на заводе и не подлежат снятию. Удалить такой порог можно, лишь вырезав его. Так что ремонт, как правило, производится без отделения детали от автомобиля.

Ремонт днища ВАЗ-2110 без сварки

При любом кузовном ремонте в первую очередь необходимо произвести внешний осмотр железа, выявить и отметить для себя, какие участки находятся в плачевном состоянии, нуждаются в ремонте или замене. Состояние металла днища определяется разными способами:

  • при помощи молотка и керна – если вы считаете, что на определенном участке присутствует ржавчина, необходимо несильно ударить по металлу, проверить, нет ли под антикоррозийным покрытием гнилого железа;
  • попробовать поднять машину на домкрате с каждой стороны – если упорные площадки подгнили, при попытке поддомкратить авто это будет заметно;
  • понажимать в разных местах на пол автомобиля – слабое, подгнившее железо будет прогибаться под ногами;
  • попытаться передвигать взад-вперед передние кресла в салоне – проблематичное перемещение сидений также нередко говорит о плохом состоянии металла.

Любой ремонт порогов и днища бессварочным способом не является профессиональным, и мастерами считается только временной мерой, чтобы по-хорошему восстановить состояние кузова, без сварочного аппарата не обойтись. Ремонтируя днище без сварки, заплатки и новые кузовные элементы не вваривают, а устанавливают на заклепках или саморезах (болтах), подготовка и вся другая работа производится так же, как и при традиционном ремонте кузова с использованием сварочного аппарата.

Выравнивание вмятин на съемном пороге

Устранить повреждения на съемном пороге значительно проще. Для подобного рода работы вам потребуется:

  • верстак или ровная опорная плита, на которой будет производиться рихтовка;
  • набор инструментов для рихтовки. В него входят всевозможные молотки (мягкие и твердые), рубанки и зубила для рихтовки;
  • болгарка и аппарат для сварки или пневмозубило.

Чтобы выровнять вмятину на съемном пороге автомобиля, необходимо действовать следующим образом:

  • отсоединить поврежденную деталь автомобиля. Для этого достаточно лишь вкрутить все крепежные болты, на которых он держался, и аккуратно вытянуть деталь;
  • установить поврежденный порог на верстак;
  • используя молотки и другие инструменты для рихтовки металлических изделий, аккуратно выгнуть все неровности в обратную сторону;
  • обработать весь порог хорошим средством против коррозии;
  • установить порог автомобиля на место.


Удаление вмятины на съёмном пороге авто

Стоит, помнить, что подобный способ вытягивания вмятин на съемном пороге автомобиля не является универсальным. Он актуален лишь в тех случаях, когда порог поврежден не слишком сильно и может быть возвращен в первоначальное состояние ударами молотка.

Однако если вмятина не подлежит ремонту, или же ее уже успела поразить ржавчина, такую деталь лучше выбросить и поставить другую на ее место. Преимуществом такого способа выравнивания вмятин является отсутствие необходимости в покраске поврежденного фрагмента — он сохранит свой первоначальный цвет.

Как выправляют порог профессионалы?

В совре­мен­ном кузов­ном ремон­те при выправ­ле­нии дефор­ми­ро­ван­ных поро­гов исполь­зу­ют­ся спот­тер и раз­лич­ные вытя­ги­ва­ю­щие устрой­ства (более подроб­но об этих устрой­ствах см. ста­тью “Спот­тер”). Сна­ча­ла с поро­га счи­ща­ет­ся защит­ное покры­тие до чисто­го метал­ла. Потом, при помо­щи спот­те­ра к поро­гу при­ва­ри­ва­ют­ся вытя­ги­ва­ю­щие эле­мен­ты, после чего осу­ществ­ля­ет­ся посте­пен­ное вытя­ги­ва­ние вмя­тин и одно­вре­мен­ное про­сту­ки­ва­ние высту­па­ю­щих мест и скла­док вокруг дефор­ма­ции, если это необ­хо­ди­мо.

После­до­ва­тель­ность вытя­ги­ва­ния осу­ществ­ля­ет­ся в зави­си­мо­сти от струк­ту­ры повре­жде­ния. Если повре­жде­на отбор­тов­ка поро­га (самая ниж­няя часть, где порог соеди­ня­ет­ся с дни­щем), то её нуж­но вер­нуть на место в первую оче­редь. Далее нуж­но выпра­вить углы поро­га, если они замя­ты. Таким обра­зом, сна­ча­ла нуж­но вер­нуть основ­ную фор­му поро­гу, а вто­ро­сте­пен­ные неров­но­сти выправ­ля­ют­ся в послед­нюю оче­редь. Неглу­бо­кие вмя­ти­ны мож­но выправ­лять молот­ком обрат­но­го дей­ствия, кото­рый есть в ком­плек­те спот­те­ра.

Выравнивание вмятин на литом пороге

Вытянуть вмятину на литом пороге автомобиля, как правило, намного сложнее, чем на съемном. Вам потребуется больше времени и инструментов, однако такая работа вполне осуществима в домашних условиях. Метод, используемый при вытягивании вмятины, как правило, напрямую зависит от ее размеров и сложности. Наибольшей популярностью пользуются следующие методы:

  • Выправление с использованием обратного молотка. Оно используется для вытягивания небольших и несложных вмятин. Принцип действия устройства заключается в следующем: одним концом обратный молоток не слишком сильно приваривается к центру вмятины. По мере ударов грузиком об ручку вмятина будет постепенно выравниваться.


Удаление вмятины при помощи обратного молотка

  • Если у вас нет под рукой обратного молотка, вы можете поступить следующим образом: приварить к месту вмятины стальную пластину, после чего при помощи ледки или своими руками вытянуть ее вместе с поврежденной частью порога. Однако в таком случае после успешного завершения ремонта вам нужно будет срезать эту пластину и обработать соответствующим образом поверхности бывшей вмятины.
  • Если повреждения носят исключительно точечный характер, их можно выправить следующим образом: просверлить возле вмятины небольшие отверстия в пороге, продеть через них специальную арматуру с угловыми наконечниками, и, потянув на себя, выровнять повреждение. Однако такой метод актуален лишь в тех случаях, когда дефекты порога не отличаются большими размерами, а у вас есть все необходимое, чтобы тут же устранить отверстия в пороге.
  • Вытягивание с использованием вакуумной присоски. Этот тип устранения повреждений является довольно актуальным из-за того, что он сохраняет целостность лакокрасочного покрытия детали автомобиля. Но применять вакуумную присоску удается далеко не во всех случаях. Размеры вмятины и ее форма должны примерно соответствовать габаритам самой присоски — только тогда ее можно будет использовать успешно.

Принцип действия этого агрегата предельно прост: присоска прикладывается к проблемному участку поверхности порога, из нее откачивается весь воздух, обеспечивая надежное и мягкое сцепление.


Вытягивание вмятин вакуумной присоской
После этого агрегат вытягивается наружу вместе с поверхностью порога. Эти устройства могут быть разных типов, однако принцип действия у них всегда один и тот же.

  • Также для вытягивания вмятин можно использовать наковальню и различные гидравлические приспособления. Суть такого метода заключается в том, что в пороге вырезается небольшое прямоугольное окно, через которое вводится наковальня и устанавливается напротив вмятины. Далее посредством использования гидравлики вмятину можно выправить наружу. В некоторых ситуациях можно не вырезать прямоугольное отверстие, а ограничиться разрезами справа и слева от дефекта. После того как вмятина была вытянута, все отверстия необходимо заварить, обработать антикоррозийным раствором и покрасить (использование лакокрасочных материалов при реализации этого метода неизбежно).


Вырезание порога целиком
Если повреждения литой детали слишком серьезные и не могут быть устранены ни одним из вышеописанных способов, то единственное, что вам остается — это вырезать его целиком. Для этого необходимо демонтировать двери транспортного средства и покрытие сидений пола. После этого у вас есть два варианта решения проблемы: выпрямить все дефекты при помощи рихтовки на верстаке, как это проделывается со съемными порогами, или же выбросить поврежденную деталь и приварить на ее место новую.

Какой бы метод устранения вмятин на литых деталях автомобиля вы ни выбрали, ни в коем случае нельзя забывать об антикоррозийной обработке поверхности. Пороги — очень чувствительная деталь, а потому чрезвычайно уязвимы для ржавчины.

Если вы установите новый порог, при этом не защитив его от коррозии, скорее всего, вам придется снова менять его в ближайшем будущем — влага быстро проникнет во все мельчайшие дефекты на поверхности и спровоцирует образование ржавчины.

Если речь идет о перекрашивании порога автомобиля, то нужно попытаться подобрать цветовой оттенок так, чтобы он максимально совпадал со старой краской. То же касается и лака.

Автор: Баранов Виталий Петрович

Образование: среднее специальное. Специальность: автослесарь. Профессиональная диагностика, ремонт, ТО легковых авто зарубежного производства 2000-2015 г.в. Большой опыт работы с Японскими и Немецкими авто.

Некоторые советы по ремонту днища кузова

  1. Подготавливая железо для заплаток, необходимо учитывать его толщину – слишком тонкий металл будет непрочным, а толстый лист плохо проваривается и тяжелее обрабатывается.
  2. Хотя электросварка в использовании дешевле, лучше сваривать металл с помощью полуавтомата – пользоваться им проще, а сварной шов получается ровнее и аккуратнее.
  3. При вырезке кусков металла и монтаже заплаток устанавливаемая деталь должна точно подходить по размерам.
  4. При замене днища сварочный шов не может быть сплошным, так как он имеет высокую жесткость, а недостаточная эластичность отрицательно влияет на прочность кузова.

И если вы беретесь ремонтировать кузов своими руками, следует запастись терпением, аккуратно, не торопясь, выполнять все необходимые операции, не жалея времени и сил на обработку металла, очищение его от ржавчины. Некачественная подготовка и слабая антикоррозийная обработка приводит к быстрому появлению коррозии, что негативно сказывается на сроке службы кузовных элементов.

Статьи по теме:

  • Передний лонжерон ВАЗ-2109 – замена, ремонт, стоимость работ ВАЗ-2109 – автомобиль, не отличающийся крепким кузовом, железо достаточно быстро поддается коррозии, причем, ржавеют практически все кузовные детали. Замена переднего лонжерона требуется, […]
  • Особенности замены задних лонжеронов ВАЗ-2109, стоимость ремонта в автосервисе Автомобили семейства ВАЗ-2108-09 не отличаются крепким кузовом, прочным кузовным железом, особенно быстро металл ржавеет, если он не обработан антикором. Со временем на металлической […]
  • Особенности замены кислородного датчика ВАЗ-2114, признаки и причины неисправности В связи с ужесточившимися нормами экологии все автомобили стали оборудоваться дополнительными системами, уменьшающими токсичность выхлопных газов, и практически на каждой машине с […]

Action Industries.

Sommer 2110 EVO + 1-1 / 4HP Устройство открывания гаражных ворот с прямым приводом S10254
  • Привод — 2110 EVO +

  • Мощность двигателя — 1100 Н (1-1 / 4 л.с.)

  • Стандартная высота двери — Двери высотой 7 и 8 футов

  • Общая длина — 140 дюймов

  • Макс. Высота двери с надставками — 23 фута

  • Макс.скорость хода — 7.0 дюймов / сек

  • Энергопотребление (в режиме ожидания) —

  • Количество программируемых кнопок дистанционного управления — 40

  • Подключение для сигнальной лампы — Да (24 В постоянного тока / 25 Вт)

  • Радиочастота — 922,5 МГц

  • Совместимость с Homelink — Да

  • Масса брутто — 30,3 фунта

  • Габаритные размеры в упаковке — 44.5 дюймов x 7,5 дюймов x 5 дюймов

  • Соединение для кромки безопасности — Да

  • LOCK — Блокирующий магнит, который механически блокирует двигатель в любом положении с силой атаки до 660 фунтов. (сертифицирован), тем самым усиливая существующую защиту от взлома. (механизм механической блокировки открывателя

  • SENSO — Для регистрации влажности и температуры воздуха в гараже. Каретка автоматически открывает и при необходимости немного закрывает дверцу, обеспечивая идеальную циркуляцию воздуха.Это снижает риск образования плесени.

  • MEMO — Используется для расширения памяти до 450 команд передатчика. Если требуется обслуживание, сохраненные передатчики можно легко перенести на новый механизм открывания гаражных ворот

  • ДАТЧИК ДВИЖЕНИЯ — Обнаруживает движение в гараже и автоматически включает светодиодное освещение. Датчик движения крепится к дверному рычагу и подключается к моторной каретке.

  • ЗУММЕР — Две функции в одном устройстве: Зуммер тревоги распознает попытку взлома и выдает громкий звуковой сигнал.Предупреждающий зуммер издает звуковой сигнал во время закрытия.

  • LUMI EVO + — Дополнительная светодиодная подсветка блока управления. Он включается параллельно с освещением вагонов и может легко включаться и выключаться с помощью передатчика.

  • АККУМУЛЯТОРНЫЙ БЛОК АККУМУЛЯТОРНОЙ БАТАРЕИ — Встроенный в блок управления аккумуляторный блок обеспечивает питание при отключении электроэнергии. Надежное решение для резервного питания от никель-металлгидридных аккумуляторов. Срок службы до 10 раз больше по сравнению со свинцово-кислотной батареей

  • РЕЛЕ — Дополнительное реле для дополнительного включения освещения гаража или двора.

  • SOMLINK — Сервисный модуль SOMlink предлагает широкий спектр возможностей настройки новых продуктов SOMMER на вашем смартфоне или планшете с помощью веб-приложения.

  • PEARL — 4-кнопочный передатчик с частотой 922,5 МГц

  • PEARL TWIN — 2-кнопочный передатчик с частотой 922,5 МГц

  • Держатель PEARL — Держатель для установки передатчика в автомобиле или на стене — Включает двусторонний скотч.

  • TELECODY + (БЕСПРОВОДНАЯ КЛАВИАТУРА — Беспроводная клавиатура SOMMER Telecody + — позволяет управлять устройством открывания гаражных ворот SOMMER путем простого ввода личного кода.

  • ENTRAPIN + (БЕСПРОВОДНАЯ КЛАВИАТУРА) — Беспроводная клавиатура SOMMER позволяет управлять устройством открывания гаражных ворот SOMMER простым вводом личного кода. Надежное и легкое решение для тех, кто использует гараж в качестве основного входа в дом.

  • SOMCOM2 (РАДИОПРИЕМНИК В КОРПУСЕ) — Внешний приемник позволяет использовать передатчик SOMMER с марками других производителей.Также может использоваться для привратников.

  • SOMTOUCH (БЕСПРОВОДНАЯ НАСТЕННАЯ КНОПКА) — Беспроводную настенную кнопку с батарейным питанием также можно использовать в качестве пульта дистанционного управления. Управляет до 2-мя различными механизмами открывания гаражных ворот, нет необходимости прокладывать провода к механизму открывания гаражных ворот

  • Повышение порога имущественного ущерба за сообщения об авариях с прогулочными судами

    Начать преамбулу

    Береговая охрана, DOT.

    Окончательное правило.

    Береговая охрана повышает порог имущественного ущерба для сообщений об авариях с участием прогулочных судов, когда ущерб судам и другому имуществу составляет 2000 долларов или более в любой одной аварии или — это представляет собой изменение по сравнению с Уведомлением о предлагаемом нормотворчестве — когда происходит столкновение с участием два и более судна, независимо от размера материального ущерба. Более высокий порог лучше объясняет рост стоимости ремонта прогулочных судов.Это Окончательное правило сократит количество сообщений о несчастных случаях из-за незначительных или косметических повреждений, поможет нам поддерживать статистику за будущие годы, сопоставимые с данными за прошлые годы, и снизит нагрузку на общественность по оформлению документов для сообщения о таких происшествиях.

    Это окончательное правило вступает в силу 2 июля 2001 г.

    Комментарии и материалы, полученные от общественности, а также документы, упомянутые в этой преамбуле как доступные в досье, являются частью досье USCG-1999-6094 и доступны для проверки или копирования в Службе управления досье, U.S. Министерство транспорта, комната PL-401, 400 Seventh Street SW., Вашингтон, округ Колумбия, с 10:00 до 17:00 с понедельника по пятницу, кроме государственных праздников. Телефонный номер 202-366-9329. Вы также можете найти этот список в Интернете по адресу http://dms.dot.gov.

    Начать дополнительную информацию

    Если у вас есть вопросы по этому правилу, свяжитесь с Брюсом Шмидтом, менеджером проекта, Управление безопасности плавания, Отдел управления программами, Береговая охрана, по электронной почте bschmidt @ comdt.uscg.mil или по телефону 202-267-0955.

    Если у вас есть вопросы по просмотру списка дел, позвоните Дороти Бирд, начальнику отдела картотеки Департамента транспорта, по телефону 202-366-9329.

    Вы можете получить копию этого правила, позвонив в Инфолинию береговой охраны США по телефону 1-800-368-5647 или зайдя на веб-сайт Управления безопасности плавания по адресу http://www.uscgboating.org , или Интернет-сайт службы управления документами по адресу http: // dms.dot.gov.

    Конец Дополнительная информация Конец преамбулы Начать дополнительную информацию

    Предпосылки и цель

    20 июня 2000 г. мы опубликовали Уведомление о предлагаемом нормотворчестве (NPRM), озаглавленное «Повышение порога имущественного ущерба для сообщений об авариях с участием прогулочных судов» (65 FR 38229). Мы получили 17 писем с комментариями к предложенному правилу. Никаких публичных слушаний не запрашивалось и не проводилось.

    Регулирующий орган и история

    46 U.S.C. 6101 требует, чтобы секретарь (который делегировал полномочия коменданту) предписывал правила сообщения о «морских авариях». Мы используем эти полномочия для описания различных типов морских аварий, в том числе тех, которые связаны с определенным размером имущественного ущерба, о которых должны сообщать различные стороны. 33 CFR Part 173, Subpart C, содержит правила, применимые к прогулочным судам.

    В 1972 году порог имущественного ущерба для сообщений об авариях с прогулочными судами составлял 100 долларов.(Это был исходный порог.) В 1979 году влияние инфляции на исходный порог потребовало повышения порога до 200 долларов. Целью данной корректировки было уменьшение количества отчетов о незначительных инцидентах.

    Однако даже порог в 200 долларов в конечном итоге привел к подаче чрезмерного количества отчетов о происшествиях по незначительным происшествиям. Эта тенденция увеличила бремя отчетности для публики, занимающейся водными видами спорта, и административное бремя как для Штатов, так и для береговой охраны.6 февраля 1989 г., чтобы уменьшить это бремя, мы опубликовали Окончательное правило (54 FR 5608), повышающее порог до 500 долларов. Как и в 1979 году, в основе этого изменения лежало влияние инфляции на затраты на ремонт.

    Формула, описанная в преамбуле Окончательного правила 1989 г., основывалась на методологии, позволяющей нам ежегодно корректировать пороговое значение, применяя дефлятор, основанный на валовом национальном продукте (ВНП), для учета инфляции. В этой преамбуле мы также заявили о своем намерении ежегодно пересматривать пороговое значение и, при необходимости, корректировать пороговое значение каждый раз, когда он повышается еще на 100 долларов.

    Как мы разработали новую методологию корректировки порога

    Проанализировав формулу, описанную в преамбуле Окончательного правила 1989 г., мы определили, что необходимы дальнейшие корректировки как порогового значения, так и методологии, использованной для его определения. Отчеты об авариях, не связанных с безопасностью полетов, продолжали поступать даже после того, как пороговое значение выросло до 500 долларов в 1989 году. Теперь мы считаем, что пороговое значение было слишком низким, и что сама методология была неправильной. Индекс инфляции, основанный на ВНП и примененный к значению 500 долларов за базовый год, дает порог на 2001 год, все еще достаточно низкий для сообщения о слишком большом количестве убытков, которые носят чисто косметический характер.Мы решили, что необходимо скорректировать значение порогового значения для базового года, чтобы достичь уровня, только когда ущерб в результате аварий связан с безопасностью.

    Национальная ассоциация администраторов судов штата (NASBLA) — это профессиональная ассоциация, состоящая из должностных лиц штатов, содружеств и провинций, ответственных за исполнение или обеспечение соблюдения законов этих органов о лодках. В рамках NASBLA Комитет по расследованию, отчетности и анализу происшествий на лодках (BAIRAC) отвечает за отчетность и анализ происшествий.

    Администраторы закона о судоходстве (BLA), работающие в BAIRAC, являются экспертами в области правоприменения, обучения технике безопасности на лодках и в расследовании происшествий на лодках. Благодаря своим постоянным отношениям с предприятиями, занимающимися ремонтом прогулочных судов, а также своему опыту и знаниям о различных типах повреждений лодок и затратах на их ремонт, они убедительно заявили, что Береговая охрана должна поднять порог имущественного ущерба. для отчетов об авариях с участием прогулочных судов до уровня, который точно отражает текущие цены на лодки и затраты на ремонт.

    BAIRAC призвал береговую охрану инициировать нормотворчество, чтобы поднять порог для сообщений об авариях, связанных только с материальным ущербом, с 500 долларов до 2000 долларов, а также изменить условия отчетности, чтобы включить все аварии, связанные со столкновением двух или более судов. BLA и береговая охрана согласились с тем, что порог в 2000 долларов для тех аварий, связанных только с материальным ущербом, позволит расследователям авиационных происшествий государств сосредоточить внимание на сообщениях о повреждениях, связанных с безопасностью, и исключит большинство сообщений о косметических повреждениях.Однако, как мы заявили в опубликованном нами в 2000 году NPRM, мы тогда не видели преимущества требования отчетов обо всех авариях, связанных со столкновением двух или более судов, независимо от размера ущерба собственности.

    В этом NPRM мы попытались определить уровень косметического ущерба, используя данные, содержащиеся в базе данных отчетов о происшествиях на лодке (BARD). Данные за 1998 год показывают, что 1718 зарегистрированных столкновений двух или более судов повлекли за собой только имущественный ущерб. Из этих 1718 1002 причинены имущественный ущерб ниже предлагаемого порога в 2000 долларов.Присмотревшись к данным, мы обнаружили, что почти 90% из этих 1002 были связаны с материальным ущербом на уровне 1500 долларов или ниже. В то время мы считали большинство из них скорее косметическими, чем связанными с безопасностью, несмотря на то, что они были связаны с столкновениями. Таким образом, признавая необходимость сокращения количества отчетов о незначительных или косметических повреждениях, необходимость снижения административной нагрузки на общественность и государства, в которых сообщается о таких повреждениях, а также необходимость того, чтобы расследователи авиационных происшествий в государствах сосредоточивали внимание на вопросах, связанных с безопасностью полетов. повреждения, мы не планировали требовать отчеты обо всех авариях, связанных со столкновением двух или более судов.Однако, как станет ясно из нашего обсуждения комментариев, наша позиция изменилась. Теперь мы полностью согласны с BAIRAC в том, что мы должны требовать отчеты о таких авариях, независимо от размера ущерба собственности.

    Порог имущественного ущерба для сообщений об авариях с участием прогулочных судов, когда ущерб судам и другому имуществу составляет 2000 долларов или более в любой одной аварии или авариях, связанных со столкновением двух или более судов, независимо от размера ущерба собственности, составляет минимум, установленный федеральным правилом; но государства могут устанавливать более строгие требования.Таким образом, государство может потребовать отчеты обо всех несчастных случаях, даже если каждый отчет приводит только к материальному ущербу ниже порогового значения в 2000 долларов.

    Мы также определили, что необходимо найти индекс инфляции, который более точно отслеживал бы тенденции в судоремонтной отрасли, чем ВНП. ВНП дает общую рыночную стоимость всех конечных товаров и услуг, произведенных в США за данный год. В него входят расходы всех секторов экономики. Таким образом, дефлятор ВНП измеряет все изменения цен, влияющие на потребителей, частный сектор и правительство.

    Индекс цен производителей (PPI) — это альтернативный индекс инфляции. Он дает среднее изменение цен, полученных продавцами отечественных товаров и услуг с течением времени. Данные, составляющие PPI, сгруппированы по отраслям и продуктам, что позволяет найти конкретные данные о ценах на ремонт невоенных катеров. Эти данные позволяют отслеживать конкретные изменения цен на ремонт прогулочных катеров. Поскольку это нормотворчество касается именно этих цен, мы считаем, что PPI более подходит для измерения изменений этих цен с соответствующим порогом имущественного ущерба для отчетов об авариях с участием этих судов.

    Как мы рассчитываем новый порог. Для 2001 года и далее мы будем использовать PPI для стандартной отраслевой классификации (SIC) 3732 «Строительство и ремонт лодок: ремонт лодок невоенного назначения», чтобы рассчитать порог. Новое значение на 2001 год в размере 2000 долларов будет служить базовым значением. Чтобы рассчитать значение порога для 2002 г. с использованием 2001 г. в качестве базового года, необходимо выполнить следующий расчет:

    (Базовый порог на 2001 год) × ([ИЦП на 2002 год] / [ИЦП на 2001 год])

    Например, если предварительная оценка PPI Бюро статистики труда на 2002 год составляла 191.0, а для 2001 года было 189,0, расчет будет следующим:

    2000 долл. США × (191,0 / 189,0) = 2 021,16 долл. США

    Поскольку это увеличение, округленное до ближайших 100 долларов, меньше 500 долларов, пороговое значение останется на уровне 2000 долларов. (Увеличение в 500 долларов достаточно мало, чтобы служить интересам безопасности, но не настолько мало, чтобы повлечь за собой слишком частые изменения порогового значения.) Мы будем рассчитывать увеличение каждый год; как только она, округленная до ближайших 100 долларов, достигнет 500 долларов, мы соответственно поднимем порог.

    Обсуждение комментариев и изменений

    Всего мы получили 17 комментариев по предлагаемым поправкам к правилам. Одиннадцать комментариев поступили от BLA и двенадцатый от NASBLA. Двое прибыли из организаций, занимающихся водными видами спорта, два — от представителей широкой общественности и один — от адъюнкт-профессора по вопросам образования и исследований в области безопасности. Из 17, один из штата Калифорния прибыл после даты закрытия 18 октября 2000 г .; мы приняли его из-за большого количества отчетов об авариях, ежегодно составляемых государством, около 10 процентов всех зарегистрированных аварий, происходящих там, и потому, что мы могли принять его без ущерба для других участников нормотворчества.

    Двенадцать комментариев, включая семь, представленные BLA, и один, представленный NASBLA, поддержали повышение порога имущественного ущерба до 2000 долларов или более. Пять из этих двенадцати комментариев также поддержали требование сообщать обо всех авариях, связанных со столкновением двух или более судов, независимо от размера имущественного ущерба.

    Остальные пять комментариев, включая оставшиеся четыре, представленные BLA, вообще выступили против повышения порога имущественного ущерба.

    Ниже приводится краткое изложение каждого отрицательного комментария:

    В первом говорится, что опубликованные цифры аварий уже в 16 раз занижены, и что повышение порога только ухудшит ситуацию. Далее он заявил, что всю систему сообщений об авариях необходимо усилить, а не ослабить.

    Второй, из штата Алабама, предложил полностью отменить порог. Он утверждал, что размер имущественного ущерба не имеет значения для анализа аварий с целью их предотвращения.В нем также представлены критерии для сообщения о них, которые государство использует около 15 лет.

    Третий представитель штата Коннектикут утверждал, что стоимость материального ущерба сама по себе не является справедливым показателем безопасности и что принятие пересмотренного порогового значения может исключить возможность сообщения о многих серьезных авариях с участием небольших судов. Далее, он соглашается с NASBLA, что любые сообщения должны охватывать все столкновения с любым количеством судов. И наконец, на странице Start Printed Page 21673 говорится, что устранение или отказ от обязательного сообщения обо всех таких столкновениях, вероятно, снизит ценность BARD в иллюстрации разнообразия несчастных случаев на лодках, свидетелями и расследованными в Коннектикуте.

    Четвертый, представленный штатом Огайо, представил множество аргументов против повышения порога. (1) Нам не удавалось отличить то, что мы называли «незначительным или косметическим повреждением» от того, о чем мы считали ущерб, о котором следует сообщить. (2) Мгновенное увеличение порога с 500 до 2000 долларов исключит статистическую сопоставимость для большинства несчастных случаев. (3) Хотя Береговая охрана желает уменьшить нагрузку на общественность по оформлению документов, (а) Конгресс, который ввел в действие систему отчетности, должно быть, постановил, что информация оправдывала это бремя; (б) порог в 2000 долларов является абсолютно произвольным и субъективным, без соответствующего опыта; (c) Береговая охрана, по-видимому, использовала критерий, отличный от инфляции, в качестве фактора для определения увеличения с 200 долларов в 1979 году до 500 долларов в 1989 году; и (d) Береговая охрана не определила «несчастный случай, не связанный с безопасностью», она не предложила никаких полномочий для рассмотрения исключительно «происшествий, связанных с безопасностью», и не указала, почему один уровень «материального ущерба» »Является его должным делом, в то время как другое — нет.(4) Если береговая охрана принимает требование BAIRAC о предложении этого изменения, она также должна следовать полной рекомендации BAIRAC, в частности, призыву покрыть все аварии, связанные со столкновением двух или более судов, независимо от суммы ущерба в долларах. (5) Чтобы установить порог на «надлежащую» сумму сейчас, Береговая охрана должна либо установить его на уровне 500 долларов (где он был получен в 1989 году), но с этого момента повысить его с помощью PPI, либо снизить его до исходных 100 долларов и поднять. это соответственно с PPI.И, наконец, (6) система сообщения о несчастных случаях возникла в первую очередь для того, чтобы принести пользу водному сообществу, и при правильном управлении она будет не бременем, а, скорее, преимуществом.

    Пятый, представленный штатом Калифорния, заявил, что мы не продемонстрировали, что все несчастные случаи, в которых материальный ущерб составляет менее 2000 или даже 500 долларов, менее важны для установления причинно-следственной связи, чем те, в которых он падает выше 2000 долларов. Калифорния считает, что даже аварии с номинальным ущербом могут помочь в выявлении проблем и могут принести пользу специалистам по безопасности полетов, поскольку они разрабатывают программы безопасности для нужд, возникающих в их штате.Кроме того, Калифорния рекомендует сообщать обо всех авариях, вызванных факторами, находящимися под контролем операторов, а также авариях, связанных с дефектами оборудования, немаркированными опасностями и другими вопросами, имеющими отношение к безопасности. При анализе любой аварии Калифорния рассматривает два вопроса: можно ли было бы избежать этой аварии, если бы этот оператор действовал более осмотрительно, и можно ли было бы избежать этой аварии, если бы не дефекты оборудования, немаркированные опасности и другие факторы. .Если ответ положительный на любой из вопросов, Калифорния очень серьезно относится к этой аварии при разработке программ безопасности.

    В один комментарий была включена рекомендация прояснить, что отчеты потребуются, когда ущерб в результате аварии не просто превышает, а составляет 2000 долларов. Таким образом, последнее правило будет гласить не «Ущерб судам и другому имуществу составляет более 2 000 долларов США в результате аварии * * *», а «Ущерб судам и другому имуществу составляет 2 000 долларов США или более в результате аварии * * *»

    После тщательного рассмотрения всех вышеперечисленных комментариев береговая охрана решила поднять порог имущественного ущерба для отчетов об авариях с участием прогулочных судов до уровня, при котором такой ущерб составляет 2000 долларов или более в результате аварии, и требовать отчетов об авариях для столкновений с участием два и более судна, независимо от размера имущественного ущерба.Более высокий порог вступит в силу на оставшуюся часть 2001 календарного года после ДАТЫ ДЕЙСТВИЯ .

    Наше решение внести поправки в предлагаемое правило, чтобы требовать отчетов об авариях при столкновениях с участием двух или более судов, независимо от размера имущественного ущерба, основывается на информации, предоставленной пятью комментариями, которые поддерживают требование отчетов о таких авариях, а также повышение порог до уровня 2000 долларов и более — несчастный случай. Даже два из пяти отрицательных комментариев согласились с BAIRAC, требуя сообщать о таких авариях.Основное оправдание для сообщения обо всех таких авариях заключается в том, что они произошли в результате нарушения Правил навигации (то есть отсутствия надлежащего наблюдения, чрезмерной скорости, опрометчивой эксплуатации и т. Д.). Мы согласны и добавляем, что эти аварии обязательно связаны с безопасностью.

    Со временем столкновения с участием двух или более судов являются наиболее часто регистрируемым видом происшествий; ежегодно на них приходится около трети всех зарегистрированных несчастных случаев. За 1999 год BARD показывает 2 774 таких несчастных случая. Из них 1707 (почти две трети) привели только к материальному ущербу: ни погибших, ни раненых.Средний ущерб для каждого из этих 1707 человек составил около 2900 долларов; но ущерб для 1023 (60%) из них составил менее 2000 долларов, а средний ущерб для этих 1023 составил около 1000 долларов. Мы признаем, что исключение этих 1023 несчастных случаев (около 12 процентов всех зарегистрированных несчастных случаев) только из-за небольшого ущерба может поставить под угрозу качество и объем данных, собираемых BARD. Во-вторых, отсутствие 1023 аварий, большинство из которых или все были вызваны нарушением Правил навигации, снизило бы полезность данных для построения программ безопасности.Наконец, мы не хотим упускать ценные данные о факторах, контролируемых операторами менее дорогих лодок, только потому, что их лодки ремонтируются с меньшими затратами. Мы согласны с тем, что отчетность обо всех столкновениях с участием двух или более судов важна как для понимания происшествий, связанных с безопасностью, в любой момент, так и для отслеживания статистики с течением времени. Таким образом, польза для общественности от сбора этих данных перевешивает нагрузку на общественность, связанную с их предоставлением.

    В заключение, наша цель — поднять порог для сообщения о повреждении имущества до уровня, при котором мы собираем почти все полезные данные и почти не используем бесполезные.Ущерб, о котором следует сообщать, включает в себя повреждение, причиной которого является безопасная эксплуатация и навигация судна, а последствия — «конструктивная целостность» или «мореходные качества» судна. Ущерб, о котором следует сообщить, по определению стоит бумажной работы, связанной с сообщением. А более избирательная отчетность может дать только более полезную статистику. Опять же, государства по-прежнему могут собирать все данные, которые им нужны.

    В нашем предыдущем Окончательном правиле (54 FR 5608 (6 февраля 1989 г.)) мы предложили повышать порог с шагом в 100 долларов с течением времени, чтобы обеспечить корректировку порога до соответствующего уровня.Тем не менее, с тех пор мы его не поднимали. Более того, мы сомневаемся, что даже установленный тогда порог в 500 долларов был достаточно высоким, и подозреваем, что методика, использованная для его расчета, была неправильной. (Например, применение этой методологии к последнему порогу привело бы к пороговому значению в $ 700 на сегодняшний день. Наше исследование предполагает, и большинство комментариев подтверждают, что такой порог не позволит охватить многие полезные данные.)

    Мы будем пересматривать новый порог каждый год. Когда он должен увеличиться на 500 долларов, мы поднимем его до соответствующего уровня с помощью соответствующих средств: выработки правил с уведомлениями и комментариями с участием всех желающих сторон.

    Нормативная оценка

    Это Окончательное правило не является «существенным нормативным актом» в соответствии с разделом 3 (f) Исполнительного указа 12866 и не требует оценки потенциальных затрат и выгод в соответствии с разделом 6 (a) (3) этого Указа. Управление по управлению и бюджету (OMB) не рассматривало это Правило «Начало печатной страницы» в соответствии с указанным приказом. Это не является «значительным» в соответствии с нормативной политикой и процедурами Министерства транспорта (DOT) (44 FR 11040 (26 февраля 1979 г.)).Мы ожидаем, что экономическое воздействие этого правила будет настолько минимальным, что полная нормативная оценка в соответствии с параграфом 10e нормативной политики и процедур DOT не требуется.

    Стоимость правила

    Это Окончательное правило не налагает дополнительных денежных затрат на оператора или владельца прогулочного судна или кого-либо еще. Напротив, это снизило бы затраты, которые накладывает текущее правило.

    Преимущества правила

    Повышение порога имущественного ущерба для сообщений об авариях с участием прогулочных судов до 2000 долларов США или более в случае аварии и требование о сообщении об авариях, связанных со столкновением двух или более судов, независимо от суммы ущерба, на протяжении большей части оставшейся части 2001 года принесет пользу владельцам и операторы прогулочных судов, а также должностные лица государств и береговой охраны, уменьшив текущее бремя подачи и обработки отчетов об авариях.В 1999 г. было зарегистрировано 1189 несчастных случаев, повлекших только материальный ущерб — без смертельных случаев и травм — а также без столкновений двух или более судов. Требование порога материального ущерба в размере 2000 долларов или более для сообщения о несчастном случае предотвратило бы публикацию следующих 1189 несчастных случаев в нашей статистике несчастных случаев за 1999 год:

    302 903 (Прочее) 9 0309 903
    Количество аварий Размер ущерба
    Опрокидывание 112 85,879
    Столкновение с неподвижным объектом 14 302 44,702
    Падение в лодке 10 5,702
    Падение за борт 14 11,661
    Пожар или взрыв 314 46 34,482
    Затопление или заболачивание 213 161,227
    Заземление 186 130,864 903 903 903 903 903 903 903 81 59,985
    Несчастные случаи лыжников 7 5,251
    Удар лодки 19 13,657
    Удар двигателем или гребным винтом 3 309 45,809
    Неизвестный тип 13 10,759
    Итого 1,189 906,498

    Для этих 1189 несчастных случаев средняя сумма ущерба составляет около 762 долларов США.00. Если бы такого уровня материального ущерба было достаточно, чтобы заявить о полной гибели конкретного судна или судов, аварии соответствовали бы федеральным требованиям к отчетности. В противном случае этот уровень повреждений будет считаться скорее «косметическим», чем «связанным с безопасностью», и, следовательно, не будет соответствовать этим требованиям.

    Малые предприятия

    В соответствии с Законом о гибкости регулирования (5 U.S.C. 601-612) мы рассмотрели вопрос о том, окажет ли это Окончательное правило значительное экономическое влияние на значительное количество малых предприятий.Термин «малые предприятия» включает малые предприятия, некоммерческие организации, которые находятся в независимой собственности и управляются и не доминируют в своих сферах, а также государственные юрисдикции с населением менее 50 000 человек.

    Это Правило применяется исключительно к частным лицам, которые владеют или эксплуатируют прогулочные суда и по определению не являются «малыми предприятиями». Кроме того, это Правило снизит нагрузку на частных граждан, сообщающих об авариях с участием прогулочных судов.

    Поскольку ожидает, что последствия этого правила будут минимальными, Береговая охрана удостоверяет в соответствии с 5 U.S.C. 605 (b), что это Правило не окажет значительного экономического воздействия на значительное количество малых предприятий. Кроме того, поскольку подавляющее большинство прогулочных судов принадлежит частным лицам, и они не являются малыми предприятиями, Закон о гибкости регулирования не применяется к большей части населения, которое регулировалось бы этим Правилом.

    Помощь малым предприятиям

    В соответствии с разделом 213 (а) Закона о справедливости регулирования малого бизнеса от 1996 г. (Pub.L. 104-121), мы предложили помочь небольшим организациям понять это Заключительное правило, чтобы они могли лучше оценить его влияние на них и участвовать в нормотворчестве. Мы предоставили имя, номер телефона и адрес электронной почты контактного лица для любых малых предприятий, которые считали, что Правило повлияет на их малый бизнес, организации или государственные юрисдикции, или у которых есть вопросы относительно его положений или вариантов соблюдения.

    Малые предприятия могут направлять комментарии к действиям федеральных служащих, которые обеспечивают соблюдение или иным образом определяют соответствие федеральным правилам Уполномоченному по правам человека в сфере малого бизнеса и сельского хозяйства и Региональным советам по справедливости регулирования малого бизнеса.Омбудсмен ежегодно оценивает эти действия и оценивает степень реагирования каждого агентства на малый бизнес. Если вы хотите прокомментировать действия сотрудников береговой охраны, звоните по телефону 1-888-REG-FAIR (1-888-734-3247).

    Сбор информации

    Это Окончательное правило не требует нового сбора информации в соответствии с Законом о сокращении бумажного документооборота 1995 г. (44 U.S.C. 3501-3520). Фактически, это должно привести к фактическому сокращению бумажной работы, поскольку требует отчетов о меньшем количестве несчастных случаев.

    Федерализм

    Мы проанализировали это Окончательное правило в соответствии с E.O. 13132, Федерализм, и определили, что он не имеет достаточных последствий для федерализма, чтобы гарантировать подготовку оценки федерализма. Государства по-прежнему вправе вводить более строгие требования к сообщениям об авариях с участием прогулочных судов. Начать печатную страницу 21675

    Закон о реформе необеспеченных мандатов

    Закон о реформе необеспеченных мандатов 1995 г. (2 U.S.C. 1531-1538) требует, чтобы федеральные агентства оценивали последствия своих регулирующих действий, специально не требуемых законом. В частности, в Законе рассматриваются действия, которые могут привести к расходам государственных, местных и племенных органов власти в совокупности или частного сектора в размере 100 000 000 долларов США или более в течение любого года. Хотя это Окончательное правило не приведет к таким расходам, мы обсуждаем последствия этого правила в другом месте этой преамбулы.

    Изъятие частной собственности

    Это Заключительное правило не будет влиять на изъятие частной собственности или иным образом иметь последствия в соответствии с Правительственным указом 12630 «Действия правительства и вмешательство в права собственности, охраняемые Конституцией».

    Реформа гражданской юстиции

    Это Заключительное правило соответствует применимым стандартам в разделах 3 (a) и 3 (b) (2) Исполнительного указа 12988, Реформа гражданского правосудия, чтобы минимизировать судебные разбирательства, устранить двусмысленность и уменьшить бремя.

    Защита детей

    Мы проанализировали это Заключительное правило в соответствии с Правительственным указом 13045 «Защита детей от рисков для здоровья в окружающей среде и рисков для безопасности». Это Правило не является экономически значимым правилом и не касается экологического риска для здоровья или риска для безопасности, который может непропорционально сильно повлиять на детей.

    Правительства индейских племен

    Это правило не имеет племенных последствий в соответствии с Указом правительства 13175 «Консультации и координация с правительствами индейских племен». Правило с племенными последствиями оказывает существенное прямое влияние на одно или несколько индейских племен, на отношения между федеральным правительством и индейскими племенами или на распределение власти и ответственности между федеральным правительством и индейскими племенами.

    Окружающая среда

    Мы рассмотрели влияние этого Заключительного правила на окружающую среду и пришли к выводу, что согласно рис. 2-1, параграф (34) (a), Командирской инструкции M16475.lC, это Правило категорически исключено из дальнейшей экологической документации. Правило просто повысит порог имущественного ущерба для сообщений об авариях с участием прогулочных судов. Определение категорического исключения доступно в досье под АДРЕСАМИ.

    Начальный список предметов
    • Морская безопасность
    • Требования к отчетности и ведению документации
    Конец списка субъектов

    По причинам, изложенным в преамбуле, Береговая охрана изменяет 33 CFR часть 173 следующим образом:

    Начало поправки, Часть

    1.Ссылка на авторитет для части 173 продолжает читать следующим образом:

    Конец поправки. Авторитет запуска

    31 U.S.C. 9701; 46 U.S.C. 2110, 6101, 12301, 12302; Циркуляр OMB A-25; 49 CFR 1.46.

    Окончание полномочий Начало поправки, Часть

    2. Измените § 173.55 (a) (3), чтобы он читался следующим образом:

    Конец поправки.

    Сообщение о несчастном случае или несчастном случае.

    (а) * * *

    (3) Ущерб судам и другому имуществу составляет 2000 долларов или более, или имеется полная потеря любого судна; или столкновение происходит с участием двух или более судов, независимо от размера материального ущерба; или

    * * * * *

    Начало поправки, Часть

    3.Измените заголовок § 173.57 следующим образом:

    Конец поправки. Начало поправки, часть

    4. Измените заголовок § 173.59, чтобы он читался следующим образом:

    Конец поправки. Начать подпись

    Датировано: 15 марта 2001 г.

    Терри М. Кросс,

    Контр-адмирал береговой охраны США, помощник коменданта по операциям.

    Конец подписи Конец дополнительной информации

    [FR Док.01-10839 Дата подачи 4-30-01; 8:45]

    КОД СЧЕТА 4910-15-У

    Низкомолекулярный ингибитор OGG1 блокирует репарацию окислительных повреждений ДНК на теломерах и усиливает противораковые эффекты метотрексата

    Культура клеток и лечение

    Клетки U2OS и BJ-TERT культивировали в среде роста Игла, модифицированной Дульбекко (DMEM; Lonza или Gibco), в то время как NTUB1 и HCT116 культивировали в среде RPMI 1640 (Gibco) и McCoy’s 5A Medium (Gibco), соответственно. Ко всем клеточным линиям добавляли 10% фетальной бычьей сыворотки (Biowest) и 100 Ед / мл пенициллин-стрептомицин (Gibco) и выращивали при 37 ° C в атмосфере 5% CO 2 .Клеточная линия остеосаркомы человека U2OS была получена от коммерческого поставщика American Type Culture Collection (ATCC). Клетки карциномы толстой кишки человека HCT116 были получены от доктора Берта Фогельштейна (Johns Hopkins, Baltimore, MD). Клетки карциномы мочевого пузыря человека NTUB1 были получены от доктора Т.С. Ли (Academia Sinica Taiwandisabled, Nankang, Тайвань). Клеточные линии BJ-Tert были предоставлены доктором W. Hahn (Институт рака Дана-Фарбер).

    Чтобы вызвать окислительное повреждение ДНК, клетки с примерно 80% слияния обрабатывали H 2 O 2 (Sigma) в концентрации 200 мкМ в бессывороточной среде DMEM в течение указанных периодов.Для выполнения ингибирования OGG1 клетки высвобождали в свежую среду, содержащую TH5487 23 или ДМСО (Sigma) в указанные времена и в указанных концентрациях. После обработки клеткам давали возможность восстановиться в полной ростовой среде в течение 1 ч, если упомянуто. Различные клеточные линии, используемые для каждого эксперимента, подробно описаны в дополнительной таблице S1. Аутентификация клеточной линии выполнялась с помощью профилирования с короткими тандемными повторами (STR), а тестирование на микоплазмы выполнялось регулярно.

    Конструирование плазмиды OGG1-GFP и трансфекция

    Вектор OGG1-GFP был создан согласно протоколу, описанному у Visnes et al. 23 . Клетки U2OS трансфицировали вектором с использованием jetPEI (Polyplus) и отбирали с помощью 1 мкг / мл пуромицина в течение 10 дней. За этим последовала клональная экспансия для создания единственного клона клеток U2OS, конститутивно экспрессирующих OGG1-GFP, и, таким образом, вариабельность уровней экспрессии была минимизирована.

    CRISPR / Cas9, нокаут OGG1

    sgRNA были сконструированы с использованием Benchling CRISPR sgRNA Design tool (http://www.benchling.com). Специфическая sgRNA была протестирована против гена OGG1 , а также был использован нецелевой (NT) контроль (sgOGG1 # 1: GTGTACTAGCGGATCAAGTA и sgNT: CCGCGCCGTTAGGGAACGAG).Эти последовательности были клонированы в вектор lentiCRISPRv2 (плазмида Addgene # 52961) и подтверждены секвенированием по Сэнгеру.

    Вирусы были получены путем временной плазмидной трансфекции в 293 Т-клетки кальций-фосфатным методом, как описано ранее 57 . Вкратце, клетки высевали при 1,1 × 10 7 клеток / чашку в 15-сантиметровые чашки за день до трансфекции. Клетки U2OS OGG1-GFP трансфицировали с использованием упаковывающих плазмид второго поколения (psPAX2 и pMD.2G, Addgene # 12260 и # 12259, соответственно) и соответствующей плазмиды для переноса (pLV CRISPR sgOGG1 или sgNT).Среду собирали через 48 ч, очищали низкоскоростным центрифугированием и фильтровали через фильтры ПВДФ (поливинилидендифторид) с размером пор 0,45 мкм (Millipore). Были рассчитаны вирусные титры, и значения варьировались от 10 7 до 10 8 МЕ / мл. Для проведения трансдукции клетки разделяли и через 24 часа трансдуцировали с использованием множественности инфицирования (MOI) 5, чтобы гарантировать высокую скорость трансдуцированных клеток. Клетки инкубировали при 37 ° C в течение 12 ч, и вирусный супернатант заменяли свежей клеточной средой.Стадия сортировки GFP-отрицательных клеток была выполнена для окончательного получения пула клеток, в котором нокаут OGG1 был подтвержден иммуноблоттингом и IF (более подробный протокол).

    IF-микроскопия и анализ изображений

    Клетки U2OS высевали в 12-луночный планшет на 24 ч до начала указанных обработок и следовали протоколу IF. Перед фиксацией клетки предварительно экстрагировали 0,2% Triton X-100 в PBS (фосфатно-солевой буфер; Sigma) в течение 2 мин (предварительная экстракция).Клетки фиксировали 4% параформальдегидом (PFA; Agar Scientific) в течение 10 мин. После промывки PBS (Sigma) проводили пермеабилизацию клеток с помощью 0,5% Triton X-100 (Sigma) в PBS в течение 15 мин. За блокированием 3% бычьим сывороточным альбумином (BSA; Sigma) в PBS в течение 1 ч следовало окрашивание первичными и вторичными антителами и 0,5 мкг / мл 4 ‘, 6-диамидино-2-фенилиндола дигидрохлоридом (DAPI; Sigma). После каждого окрашивания этап промывки трижды (каждый раз по 10 мин в PBS). В качестве первичных использованных антител были мышиные анти-TRF2 (ab13579, Abcam) при 1/200, с анти-кроличьими анти-γh3AX (2577S; Cell Signaling), анти-53BP1 (ab36823, Abcam) при 1/1000, анти-XRCC1 (ab134056; Abcam. ) при 1/200.Вторичные антитела: против Alexa 555 мыши (ThermoFisher Scientific), против Alexa 647 кролика (ThermoFisher Scientific). Все этапы выполнялись при комнатной температуре. Получение изображения осуществляли с помощью конфокального микроскопа Leica SP5 с линзой ACS APO 40,0 × 1,15 OIL. Обработка изображений проводилась с помощью программного обеспечения Leica и ImageJ, а анализ выполнялся с помощью программного обеспечения CellProfiler. Для анализа мы оценили среднюю интенсивность сигнала в теломерах для OGG1-GFP и XRCC1, как описано ранее 16 (активация BER на теломерах).Для маркеров повреждения ДНК γh3AX и 53BP1 мы измерили индекс перекрытия с маркером теломер TRF2. Наконец, частота микроядер была рассчитана с использованием программного обеспечения CellProfiler. Все эксперименты проводились не менее 2 независимых раз. Данные доступны.

    Флуоресценция теломер in situ гибридизация (Telo-FISH)

    Клетки обрабатывали 0,2 мкг / мл колцемида (Life Technologies) в течение 4 часов для обогащения клеток в метафазе. Осадки клеток подвергали гипотонической обработке 75 мМ раствором KCl, фиксировали в холодном растворе Карнуа [метанол: уксусная кислота (3: 1)] и наносили на предметные стекла.Образцы снова фиксировали в PBS, содержащем 3,7% PFA, и дегидратировали путем последовательных инкубаций в 70, 80 и 100% этаноле перед гибридизацией FISH. ДНК денатурировали при 72 ° C в 1 M HCl, 20-кратном солевом растворе цитрата натрия (SSC) и смеси для гибридизации деионизированного формамида и гибридизовали с Cy3-меченным (CCCTAA) 3 теломерным зондом с пептидной нуклеиновой кислотой (PNA) (0,5 мкг / мл) [Panagene, PNA BIO / F1001 (TelC-FAM)]. Наконец, слайды промывали буфером, содержащим такой же высокий процент формамида, чтобы удалить неспецифически связанный зонд, и ДНК окрашивали 0.5 мкг / мл раствор DAPI / Antifade (Palex Medical). Изображения Telo-FISH получали в цифровом виде с помощью камеры CCD (Photometrics SenSys), подключенной к микроскопу Leica DM5500B, с использованием объектива 100 × и с использованием программного обеспечения CytoVision 7.2. Изображения были проанализированы вслепую, чтобы оценить хромосомный мульти-теломерный сигнал или свободные от сигнала концы.

    Сортировка клеток

    Клетки U2OS трипсинизировали, ресуспендировали при концентрации 5 × 10 6 клеток / мл и инкубировали с 5 мкг / мл Hoechst в течение 15 минут при 37 ° C в темноте.Клетки сортировали по количеству ДНК, определяя три области для сортировки: фазы G1, S и G2 / M. Проверка чистоты после сортировки использовалась для подтверждения чистоты полученных отсортированных популяций, которая была выше 90% во всех случаях (дополнительный рисунок S1A). Сортировку проводили с использованием BD Influx (BD Biosciences). Отделенные клетки (не менее 1 × 10 6 клеток из каждой отсортированной популяции) собирали в пробирки, содержащие 0,5 мл культуральной среды, и после центрифугирования осадок клеток хранили при -20 ° C до использования для экстракции ДНК или белка.

    Анализ образования колоний

    Клеток U2OS (OGG1-GFP или OGG1-KO) с ДМСО или с указанной концентрацией TH5487 подсчитывали и высевали на чашки Петри 10 см (500 клеток на чашку) и инкубировали до тех пор, пока размер колоний не превысил минимальный 50 ячеек (6 дней). Затем среду удаляли, и клетки заражали одним импульсом OS H 2 O 2 (Sigma) при 200 мкМ в бессывороточной среде DMEM в течение 1 ч). Затем обработку удаляли, и клетки высевали в полную среду в присутствии или в отсутствие TH5487 (10 мкМ) в течение 6 дополнительных дней.Наконец, клетки дважды промывали PBS, фиксировали ледяным метанолом (Sigma) в течение 5 минут и окрашивали 1% раствором кристаллического фиолетового (Sigma) в течение 30 минут. После тщательной промывки в водопроводной воде и сушки на воздухе. Планшеты сканировали и измеряли относительную площадь колоний с помощью программного обеспечения ImageJ. Этот эксперимент проводился один раз. Данные доступны.

    Экстракция ДНК, очистка человеческого OGG1 и относительное количественное определение окисленных оснований в определенных областях генома с помощью количественной ПЦР (кПЦР)

    ДНК

    экстрагировали из культивируемых клеток с помощью набора Flexigene DNA Kit (Qiagen) в соответствии с инструкциями производителя и количественно определяли флуорометрическим анализатором PicoGreen. анализ (Thermo Fisher Scientific).

    Мы адаптировали ранее описанный протокол окисления теломер 27 для количественной оценки относительного накопления окисленных оснований в определенных областях генома путем инкубации ДНК с белком hOGG1, который был предварительно очищен, как сообщалось ранее 23 . Это метод кПЦР, который основан на различиях в кинетике ПЦР между матричной ДНК, расщепленной OGG1, и непереваренной ДНК. Этот фермент распознает и разрезает 8-oxoG, создавая абазические сайты, которые превращаются в SSB за счет его AP-лиазной активности.Эти SSB ингибируют ПЦР, таким образом, ΔCt после переваривания ДНК OGG1 (переваренная Ct – непереваренная Ct) пропорциональна окислительному повреждению в амплифицированной области (дополнительный рисунок S1B). Условия, используемые для инкубации: 2,4 мкМ hOGG1 в течение 4 ч в буфере для ДНК-гликозилазы (25 мМ Трис-HCl, 15 мМ NaCl, 2 мМ MgCl 2 , 0,0025% Твин-20 при pH = 8). Реакцию останавливали инкубированием при 95 ° C в течение 5 минут. Анализ qPCR проводили на 40 нг расщепленной или непереваренной геномной ДНК с использованием тех же реагентов, праймеров и условий, которые описаны в исходном протоколе 27 .Каждую количественную ПЦР выполняли в трех экземплярах, включая контроли без шаблона, в системе Abi QuantStudio 6 Flex для ПЦР в реальном времени (Applied Biosystems). Используемые праймеры перечислены в дополнительной таблице S2. Шесть независимых экспериментов были включены для каждого условия и проанализированы в трех повторностях. Данные доступны.

    Экстракция, количественная оценка и иммуноблоттинг белка

    Экспрессия белка определялась иммуноблоттингом. Вкратце, осадки клеток получали в буфере для анализа радиоиммунопреципитации (RIPA) (Sigma) в присутствии коктейля ингибиторов протеаз (Roche).Концентрацию общего белка определяли с использованием набора Pierce BCA Protein Assay Kit (Thermo Fisher Scientific) в соответствии с инструкциями производителя. Сорок микрограммов белка подвергали электрофорезу с помощью электрофореза в 12% додецилсульфат натрия в полиакриламидном геле (SDS-PAGE) и переносили на мембраны Immobilon-FL (Millipore). Мембраны блокировали трис-забуференным физиологическим раствором с Твин-20 (TBS-T; 50 мМ Трис / HCl, 150 мМ NaCl, pH 7,5 плюс 0,2% Твин-20) и 5% обезжиренным молоком в течение 1 ч при комнатной температуре.Блоты зондировали следующими первичными антителами: кроличьи анти-OGG1 (ab124741, Abcam) в разведении 1/2500 и мышиные анти-β-актин (A5441; Sigma) в разведении 1/10 000 в TBS-T, содержащем 5% не- жирное молоко. В качестве вторичных антител использовали антитела против мышиного и кроличьего IgG-HRP (иммуноглобулин G пероксидаза хрена; Dako), и иммуноблоты получали с использованием субстрата Immobilon Classico Western HRP (Millipore). Каждый иммуноблот выполнялся в трех экземплярах. Изображения были проанализированы с использованием программного обеспечения ImageJ (NIH Image), и уровень белка OGG1 был нормализован по уровням актина.Полноразмерные блоты представлены на дополнительном рисунке S2.

    Обнаружение внутриклеточных ROS во время фаз клеточного цикла с помощью проточной цитометрии

    Генерация внутриклеточных ROS во время клеточного цикла определялась с использованием флуоресцентного зонда 2 ‘, 7’-дихлородигидрофлуоресцеина диацетата (h3DCFDA; Molecular Probes) в сочетании с окрашиванием по Хёхсту для обнаружения Содержание ДНК. Нефлуоресцентный h3DCFDA пассивно диффундирует в клетки и превращается в высоко флуоресцентный 2 ‘, 7’-дихлорфлуоресцеин (DCF) при окислении ROS.Клетки собирали с использованием трипсина (1 ×) в течение 5 минут, осаждали и ресуспендировали в PBS, содержащем Hoechst (1 мкг / мл), в течение 15 минут. Затем клетки промывали PBS и осаждали центрифугированием. Затем осадки ресуспендировали в RPMI без h3DCFDA, содержащего сыворотку, до конечной концентрации 10 мкМ, клетки инкубировали в течение 30 минут при 37 ° C и анализировали проточной цитометрией (Navios, Beckman Coulter) с использованием FL1 (525/540 нм). или каналы FL9 (450/460 нм). Мы использовали медианное значение интенсивности h3DCFDA в качестве порога для стратификации отрицательных (ниже медианы) или положительных (выше медианы) клеток.Затем был рассчитан процент ROS-положительных клеток в фазах G1, S или G2M. Этот эксперимент проводился два независимых раза. Данные доступны.

    Иммунопреципитация хроматина (ChIP)

    ChIP выполняли, как сообщалось ранее 58 в родительских клетках U2OS или клетках U2OS OGG1-GFP. Хроматинизированную фракцию белка OGG1-GFP обогащали с использованием GFP-ловушки для иммунопреципитации (Chromotek). ДНК, связанную с OGG1-GFP, нагревали до обратного сшивания. Очищенную ДНК OGG1-GFP амплифицировали с помощью ПЦР как теломерную последовательность, так и однокопийный ген 36B4 с использованием специфических праймеров (дополнительная таблица S2).Обогащение OGG1-GFP на теломерах или 36 B4, нормализованное к входу 10%, использовали для расчета относительного обогащения OGG1 для 2 областей в клетках U2OS-GFP по сравнению с родительскими клетками U2OS. Этот эксперимент проводился 2 раза. Данные доступны.

    Взаимодействие с мишенью OGG1

    Для подготовки образцов клетки инкубировали с 20 мкМ TH5487 в течение 2 часов при 37 ° C, а затем помещали в течение 3 минут при двенадцати различных температурах в диапазоне от 37 до 62 ° C. После добавления буфера для лизиса [50 мМ Трис – HCl pH 7.5, 150 мМ NaCl, 1 мМ этилендиаминтетрауксусной кислоты (ЭДТА), 1% NP-40, 0,5% дезоксихолата натрия и 0,1% SDS с добавлением полного коктейля ингибиторов протеазы (Roche)], происходил лизис клеток путем замораживания-оттаивания. В следующем центрифугировании (30 мин при 17000 г при 4 ° C) было выполнено и 70 мкл супернатанта смешали с 23 мкл загрузочного красителя перед тем, как образцы нагревали при 95 ° C в течение 10 мин. Далее были выполнены SDS-PAGE и WB. Мембрану блокировали 5% обезжиренным молоком в течение 1 ч при комнатной температуре.В качестве первичных антител использовали кроличьи анти-OGG1 (ab124741, Abcam) 1: 1000 и мышиные анти-актин (ab6276, Abcam) 1: 5000. Этот эксперимент был проведен один раз на клетках U2OS (родительских) и один раз на клетках U2OS OGG1-GFP (не показаны). Данные доступны.

    Синергетические эксперименты

    Комбинации лекарств были созданы и распределены с использованием цифрового дозатора D300e (Tecan) в 96- или 384-луночных планшетах. Клетки высевали в 96- или 384-луночные планшеты, содержащие комбинации лекарств, с использованием Multidrop Combi Reagent Dispenser (ThermoFisher Scientific).Затем клетки инкубировали 3 дня при 37 ° C. Резазурин (R7017, Sigma) добавляли до конечной концентрации резазурина 0,01 мг / мл и измеряли флуоресценцию при ex530 / em590 после инкубации в течение 6 часов в считывающем устройстве для микропланшетов Hidex Sense (Hidex). Z-показатель синергии лекарств был рассчитан и интерпретирован с помощью Synergy Finder (http://synergyfinder.fimm.fi).

    Был начат предварительный скрининг синергии в клетках U2OS, BJ-TERT, NTUB1 и HCT116 на TH5487 с традиционными химиотерапевтическими препаратами (цисплатин, 5-флуорацил, доксорубицин, метотрексат) или ингибиторами BER (олапариб, APE1i) для выбора кандидатов.Этот первоначальный отбор проводился один раз. Для лучших кандидатов синергизм метотрексата и доксорубицина был повторен три независимых раза в четырех независимых клеточных линиях (U2OS, BJ-TERT, HCT116 и NTUB1).

    Статистический анализ

    Тест Колмогорова – Смирнова использовался для оценки того, были ли наборы данных распределены нормально. Для сравнительного анализа статистически значимые различия оценивались с помощью непарного t-критерия для нормальных распределений и U-критерия Манна – Уитни для ненормальных распределений.Статистические расчеты и графики были выполнены с использованием программного пакета SPSS версии 19.0 (IBM) и GraphPad Prism 8 (GraphPad Software Inc).

    Лечение увеличения мешка аорты после успешного EVAR у ослабленного пациента

    Открытый архив в партнерстве с Европейским обществом сосудистой хирургии

    открытый архив

    Предпосылки

    Увеличение аневризмы после эндоваскулярной пластики аневризмы (EVAR) без явной эндопротечки клиническая проблема. При лечении этой проблемы руководствуются текущими данными об адекватном последующем наблюдении за EVAR и рекомендуемыми пороговыми значениями для повторного вмешательства.У ослабленного пациента требуется тщательная оценка риска смертности, связанной с аневризмой, в сравнении с рисками, связанными с обследованиями и вмешательствами.

    Методы

    В литературе был проведен обзор методов визуализации для последующего наблюдения EVAR, а также их преимуществ и недостатков. Текущие доказательства и рекомендации относительно последующего наблюдения и повторного вмешательства после EVAR были оценены в отношении представленного случая.

    Результаты

    Чтобы обнаружить расширение мешка после EVAR, необходимы повторные исследования с той же модальностью визуализации.Подтвержденное расширение должно быть выше вариации используемого метода между наблюдателями. Хотя дуплексное ультразвуковое исследование является отличным методом для последующего наблюдения за EVAR, обнаружение значительного расширения дуплекса требует дальнейшего обследования, в первую очередь с помощью компьютерной томографической ангиографии для оценки герметичности, целостности стент-графта и наличия эндопротечки. Перед любым хирургическим вмешательством, степень которого связана с выявленной или предполагаемой причиной расширения, следует тщательно обследовать ослабленного пациента.

    Заключение

    Неспособность полностью исключить аневризму из продолжающейся циркуляции, давления и эндопротечки остается потенциальным недостатком EVAR. Значительное расширение мешка является признаком отказа EVAR. Решения относительно дальнейших обследований или вмешательства принимаются в зависимости от стабильности начального выполненного EVAR, причины и степени расширения, а также сопутствующих заболеваний пациента.

    Ключевые слова

    Аневризма брюшной аорты

    Последующее наблюдение

    Рекомендуемые статьиЦитирующие статьи (0)

    Copyright © 2015 European Society for Vascular Surgery.Опубликовано Elsevier Ltd. Все права защищены.

    Рекомендуемые статьи

    Ссылки на статьи

    Коммунальные работы в полосе отвода — транспортировка

    Временное закрытие счетчика разрешений

    Для защиты здоровья и безопасности наших сотрудников и клиентов, а также для смягчения последствий COVID-19 мы закрыли наши общедоступные стойки обслуживания клиентов в понедельник, 16 марта 2020 г. O ur счетчики закрыты до дальнейшего уведомления. Сюда входят счетчики разрешений на использование улиц и на движение и парковку в Сиэтлской городской башне на 23 и 37 этажах. Мы все еще обрабатываем заявки на получение разрешения.

    Вы можете подавать заявки на все типы разрешений онлайн через портал Seattle Services.

    Наши сотрудники будут готовы помочь вам в получении разрешений по телефону или электронной почте.

    Статусные запросы

    7 ноября 2020 года мы перейдем на нашу новую разрешительную платформу Accela.Чтобы добиться плавного перехода, наши команды будут принимать участие в обширных тренингах по новой системе в течение оставшейся части сентября и октября.

    В течение этого времени мы все еще будем обрабатывать разрешения, но будем работать с ограниченной производительностью. Поскольку наша основная задача — своевременная обработка разрешений, мы не сможем отвечать на запросы о статусе в течение этого времени, если заявка находится в рамках опубликованных сроков выдачи разрешений, опубликованных на наших веб-страницах разрешений.Благодарим вас за терпение во время этого перехода.

    Как оценить сроки выдачи разрешений на использование улиц

    Дополнительную информацию по следующим темам можно найти в справочной статье «Общие сведения о процессе получения разрешения на использование улиц, состоянии записи, целевых датах и ​​сроках разрешения».

    1. Каковы этапы процесса получения разрешения на использование улиц?
    2. Что происходит на каждом этапе разрешения и как он присваивается?
    3. Как мне проверить и понять статус записи SDOT Street Use?
    4. Что означает «Дата назначения» и как она определяется?
    5. Сколько времени занимает весь процесс получения разрешения?

    По состоянию на 10 мая 2021 г. время проверки составляет:

    Для всех типов разрешений

    • Срок подачи заявок: 3 рабочих дня

    Сроки выдачи разрешений ROWM (включая время подачи заявки)

    • Первоначальный Полный обзор: 8-9 недель
    • Единичное рассмотрение: 3-4 недели
    • Добавочный номер: 5-10 рабочих дней

    Сроки получения разрешения на благоустройство улицы (включая время подачи заявки)

    • Первоначальный Полный обзор: 7-9 недель
    • Обзор исправлений: ок.6 недель

    Сроки выдачи основных разрешений на коммунальные услуги (включая время подачи заявки)

    • Первоначальный Полный обзор: 8-10 недель
    • Проверка исправлений: 6-8 недель

    Сроки выдачи разрешений PSM (включая время подачи заявки)

    • Первоначальный Полный обзор: 10-12 недель
    • Простой просмотр: 5-8 недель

    Это средние сроки. Из-за увеличения количества заявок на получение разрешений в сочетании с сокращением мощностей наши сроки превышают обычные.Мы усердно работаем над сокращением этих сроков в преддверии перехода на Accela в ноябре.

    ПРИМЕЧАНИЕ : Если требуется совещание по Руководству по проектированию управления полосами отвода или необходимы циклы коррекции, к указанным выше временным шкалам будет добавлено дополнительное время.


    Мы объединились с Rooted in Rights, чтобы создать видео, чтобы рассказать подрядчикам и другим людям, работающим в полосе отвода, о важности обеспечения безопасного пространства для людей при перемещении по строительным площадкам.Эти советы полезны не только для инвалидов-колясочников, они делают сайты безопаснее для всех!

    Вы можете узнать больше о том, как настроить безопасный доступ через строительную площадку, в разделе «Планирование, документирование и реализация пешеходной мобильности в рабочих зонах и вокруг них» (CAM 2110).

    Шаг 1. Определение разрешения на коммунальные услуги, подходящего для вашей работы

    Доступны два типа разрешений на коммунальные услуги: второстепенное разрешение на коммунальные услуги (SUUTIL) и разрешение на крупные коммунальные услуги (SUUMP).Эти два разрешения различаются по сложности проекта и по тому, как работа повлияет на полосу отвода.

    Разрешения на мелкие коммунальные услуги (SUUTIL) охватывают несложные работы в небольших географических районах. Работа, разрешенная на основании разрешения на малые коммунальные услуги, включает:

    • Географические работы ограничены в объеме одним радиусом блока
    • Краткосрочные одиночные услуги по установке, техническому обслуживанию или ремонту инженерных сетей (газ, вода, электроэнергия, телекоммуникации и т. Д.)
    • Разведочные / разведочные / мониторинговые скважины и т. Д.
    • Установка, замена, снятие и крепление опор
    • Боковая канализация / дренажные работы одобрены Департаментом строительства и инспекции Сиэтла (SDCI)
      • Примечание: Теперь вы можете подать заявление на получение разрешения SDOT Side Sewer в любое время или запросить его во время подачи заявления на разрешение SDCI Side Sewer. Инструкции о том, как подать заявку на разрешение SDOT Side Sewer, можно найти здесь.

    Основные разрешения на коммунальные услуги (SUUMP) распространяется на более сложные проекты или работы, которые охватывают географическую зону, превышающую радиус одного квартала.Если ваш проект соответствует одному или нескольким из следующих пороговых значений, вам необходимо будет подать заявление на получение разрешения на крупное коммунальное хозяйство:

    • Географическая работа, превышающая радиус одного блока
    • Любой проект, связанный со сложными техническими проблемами * (например, глубокие раскопки), которые могут повлиять на существующие городские активы и / или инфраструктуру
    • Монтаж газопроводов диаметром более 2 дюймов
    • Прокладка инженерной линии длиной более 100 погонных футов на неартериальной или артериальной улице, включая переулки
      • Исключение: Прокладка инженерной линии протяженностью до 300 линейных футов на улице или переулке, не являющейся магистралью, в одной семье или в малоэтажной зоне может быть разрешена в соответствии с разрешением на коммунальные предприятия.
    • Удаление подземного резервуара
    • Экологические реабилитационные работы или удаление загрязненных почв
    • Работа, которая приводит к установке пандуса ADA из-за инженерных работ (например, снятие / установка опор на перекрестках с коммунальными и телекоммуникационными опорами)
    • Метод установки с направленным или горизонтальным растачиванием

    * Нам может потребоваться UMP сверх пороговых значений, указанных выше, учитывая сложность работы, включая близость к существующей инфраструктуре или активам.

    Основные объекты общественного пользования (например, водопровод, ливень, канализация и т. Д.) Теперь разрешены в соответствии с разрешением на благоустройство улиц (SIP). Посетите наш веб-сайт разрешений на благоустройство улиц для получения дополнительной информации о процессе SIP.

    К началу страницы


    Шаг 2: Подготовка документов, необходимых для подачи

    Для подачи заявки потребуются следующие документы:

    Разрешения на малые коммунальные услуги (SUUTIL)
    Тип документа Описание документа
    План защиты от столкновений с полосой отвода (ROWIP) Затворы для полосы отвода с деталями по CAM 2116
    План участка Информация о местонахождении инженерных сетей согласно CAM 2116
    Доверенность Требуется, если заявитель или контактное лицо FRP отличается от контактного лица Владельца.


    Если заявка подана по ошибке, вы можете отозвать заявку, нажав кнопку «Внести изменения» в записи, выбрав «Снятие ROW» и нажав кнопку «Продолжить заявку».Эта опция доступна только до тех пор, пока сотрудники Street Use не начнут обрабатывать заявку. Если вам нужно отменить заявку, а пункт «Внести изменения» недоступен на портале услуг в Сиэтле, вы можете отправить этот запрос по адресу [email protected]

    Вы не можете вносить какие-либо изменения в заявку после ее отправки. Если в процессе проверки необходимо внести изменения в заявку и / или документ, отправьте эти запросы на изменение по адресу [email protected]

    К началу страницы


    Шаг 3: Определение, могут ли потребоваться другие документы

    Документы, которые не требуются для подачи заявки на получение разрешения на коммунальные услуги, могут потребоваться позже в процессе получения разрешения.Ниже приведен список документов, которые могут потребоваться в зависимости от объема проекта, местоположения и типа разрешения.

    Для разрешений на коммунальные услуги следуйте приведенным ниже инструкциям. Требования к документам устанавливаются в соответствии с одним из указанных ниже этапов получения разрешения.

    Тип документа Описание документа Шаг разрешения, когда требуется документ
    План защиты от столкновений с полосой отчуждения (ROWIP) Затворы для полосы отвода с деталями по CAM 2116 Только SUUMP — Скрининг после первого цикла проверки
    Менеджер графика этапов (график проекта, как показано на портале) График строительства по фасаду Только SUUMP — Скрининг после первого цикла проверки — можно загрузить в приложении
    План управления движением (TCP) Временный план управления дорожным движением согласно CAM 2111 и Руководство города Сиэтла по управлению дорожным движением для работы на улице Либо в Application , если категория улиц вручную установлена ​​на Артериальная, либо в Скрининг , когда проверяющий проверяет, что работа ведется на главной магистрали или любой улице в Хабе, и это влияет на подвижность пешеходов, велосипедистов и / или транспортных средств

    Подтверждение временного отсутствия парковки

    (Разрешение на платную парковку)

    Если проект влияет на платную парковку, какое-то доказательство того, что разрешение на парковку было предоставлено Обзор оценки
    Прочие документы На основе местоположения проекта и воздействия; CoA исторического района, отказ от праздничного моратория согласно CAM 2107, мораторий на тротуары и т. Д. Обзор оценки
    Исправление Ответ Street Используйте лист комментариев с ответами Скрининг — невозможно отправить Исправления Отправлены, если это необходимо

    К началу страницы


    Шаг 4. Подача заявления на разрешение

    Заявки на коммунальные услуги должны подаваться через портал обслуживания в Сиэтле.Однажды на портале услуг Сиэтла:

    1. Войти
      • Если вы впервые подаете заявку на разрешение онлайн, нажмите Новые пользователи: Зарегистрируйте учетную запись , расположенную внизу страницы.
      • Чтобы увидеть преобразованные разрешения от Hansen, один из контактных лиц в преобразованных разрешениях должен будет соответствовать информации, связанной с вашей учетной записью портала услуг в Сиэтле. Для этого перейдите в справочный центр служб Сиэтла и найдите наши справочные статьи о том, как находить и искать преобразованные разрешения.
    2. В разделе Create New нажмите Permit-Street Use
    3. Выберите Utility под типом записи и выберите Minor Utility Permit или Utility Major Permit
    4. Следуйте пошаговым инструкциям, чтобы завершить процесс подачи заявки. Инструкции о том, как подать заявку на разрешение на коммунальные услуги, можно найти здесь.

    К началу страницы


    Шаг 5. Проверка статуса вашего разрешения на рассмотрении

    После того, как вы подали онлайн-заявку на разрешение, есть два способа проверить статус вашей заявки:

    1. Поиск отдельной записи в разделе «Найти существующие в разрешениях — использование улиц»
      • Щелкните вкладку Status
      • Задача приложения отображается как завершенная с зеленой галочкой
      • Задача Screening отображается как In Process с песочными часами
      • При развертывании задачи Скрининг можно увидеть срок выполнения, историю обработки задачи и активную задачу Первичная проверка
      • Следующая задача — Первичная проверка (эта задача показывает, кто назначен рецензентом Street Use)
      • Если требуются вторичные рецензенты (например,г. SDOT Traffic), они будут отображаться в задаче Screening с указанием даты и статуса после завершения задачи Screening
    2. Найдите разрешение на странице «Мои записи» в разделе «Обзор моих записей» или в разделе «Разрешение — уличное использование» .
      • Статус разрешения будет отображаться в столбце Статус

    Описание статусов наших записей можно найти здесь.

    К началу страницы


    Шаг 6. Реагирование на исправления при проверке

    Когда требуется пересмотренный и / или дополнительный документ, прежде чем мы сможем продолжить или завершить процесс проверки, будет отправлено автоматическое уведомление по электронной почте, в котором будет указано, что статус записи был изменен на «Ожидает исправлений».

    Необходимые документы будут указаны в качестве условия разрешения. Для получения подробных сведений о каждом условии нажмите кнопку Просмотреть условие в записи.

    Если требуется условие ответа по исправлению, вам необходимо загрузить лист комментариев по использованию улиц с вашими ответами.

    Чтобы загрузить лист комментариев об использовании улиц и размеченные документы (если применимо), перейдите на вкладку вложения своей записи и щелкните синюю гиперссылку каждого документа, который вы хотите загрузить.

    После того, как отредактированные и / или дополнительные документы будут готовы к отправке, нажмите кнопку Загрузить на вкладке Вложения .

    Инструкции по реагированию на исправления можно найти здесь.

    К началу страницы


    Шаг 7. Выдача разрешения

    Как только ваш отзыв будет одобрен, вы получите электронное письмо о том, что ваше разрешение было выдано. Если есть сборы, в электронном письме будет указано, что ваше разрешение готово к выдаче после оплаты. Вы можете узнать больше о том, как оплатить разрешение в Accela, здесь.

    Войдите в Seattle Services Portaland и откройте запись о разрешении.Вы сможете распечатать свое разрешение и все утвержденные документы, находящиеся на вкладке «Вложения» в записи.

    Инструкции о том, как найти разрешение и другие приложения к документу, можно найти здесь.

    Информацию о разрешительных сборах и способах их расчета можно найти на нашем веб-сайте «Как рассчитывать и оплачивать сборы за разрешения».

    К началу страницы


    Шаг 8: Планирование уведомления о начале работы и временного запрета на парковку

    Перед запуском вашего проекта вам нужно будет уведомить нас о том, когда ваш проект начнется, запланировав уведомление о начале работы.Просмотрите утвержденные планы и внимательно ознакомьтесь со всеми условиями вашего разрешения, а затем запланируйте начало работы.

    Чтобы запланировать уведомление о запуске задания, следуйте приведенным здесь инструкциям.

    Для получения дополнительной информации об инспекциях посетите наш веб-сайт инспекций.

    Если вам необходимо зарезервировать неоплачиваемое парковочное место, следуйте инструкциям на нашем веб-сайте Временного запрета на парковку.

    К началу страницы


    Шаг 9: Подача заявки на внесение поправок для изменения / продления вашего разрешения

    После выдачи разрешения необходимо внести изменения в заявку, объем работ и / или дату, подав заявку на внесение поправок через портал обслуживания в Сиэтле.

    Изменения имеют другие (более короткие) этапы процесса, чем первоначальная заявка. Для внесения поправки документы не требуются, но могут быть загружены по желанию.

    Когда выпускается Поправка, она обновляет информацию о своей родительской (начальной) разрешительной записи.

    После выдачи разрешения будут доступны следующие типы поправок:

    Изменение даты Поправка — используется для запроса изменения даты начала использования в выданном разрешении до начала использования.

    • Использование не может быть добавлено или продлено, а продолжительность не может быть изменена
    • Невозможно запросить изменение объема работ и / или заявки
    • В зонах концентраторов вам необходимо согласовать даты, выходящие за рамки первоначальных дат выпуска и периодов продления, прежде чем продолжить работу (электронная почта [email protected])
    • Инструкции по подаче заявки на изменение даты можно найти здесь.

    Поправка о продлении — используется для запроса на продление существующего (ых) использования (й) выданного разрешения

    • Использование не может быть добавлено
    • Невозможно запросить изменение объема работ и / или заявки
    • В областях Hub вам нужно будет согласовать даты, выходящие за рамки первоначальных дат выпуска и периодов продления, прежде чем продолжить работу (электронное письмо SDOTConstructionHub @ seattle.gov)
    • Инструкции по подаче заявки на поправку о продлении можно найти здесь.

    Поправка к редакции — используется для запроса изменений информации о приложении (контакт, адрес и / или соответствующая информация), изменения объема работ (изменение рабочей зоны, добавление или удаление использования) и / или расширения существующего использования (я)

    • Заявку и объем работ можно запросить в описании поправки
    • Использование может быть добавлено и расширено
    • Изменения объема работ потребуют загрузки исправленных документов (например,г. ROWIP, план участка, TCP, график проекта и т. Д.), И необходимо будет выполнить полную проверку
    • Инструкции по подаче заявки на внесение поправок в редакцию можно найти здесь.

    Уведомление об аварийных работах и ​​требования к разрешениям

    Аварийные работы — это когда общественное здоровье, безопасность и / или благополучие находятся под угрозой. При аварийных работах следует немедленно принимать меры для обеспечения здоровья и безопасности населения. С инспектором SDOT Street Use следует связаться, как только группа реагирования начнет мобилизацию.Заявление о разрешении на выполнение аварийных работ необходимо подать в течение 24-48 часов после начала ответных работ.

    Чтобы указать, что работа связана с аварийной ситуацией, объясните аварийные работы в описании проекта и местоположения и выберите «Экстренное» разрешение в процессе подачи заявки. Чтобы подать заявку на разрешение, необходимо загрузить простой план воздействия на полосу отвода (ROWIP), который как минимум показывает место работы.

    Если экстренные работы продолжаются более 5 календарных дней, необходимо подать заявку на внесение поправок на портале обслуживания в Сиэтле и загрузить необходимые документы в соответствии с Шаг 3 выше.

    Если после аварийных работ требуются дополнительные работы, необходимо применить поправку к редакции согласно Шаг 9 выше.

    Истечение срока действия разрешения по сравнению с истечением срока использования (шестимесячный срок действия)

    Разрешения на коммунальные услуги теперь имеют 6-месячный срок действия, что позволяет завершить этапы строительства в течение 6-месячного периода.

    Продление срока использования в течение 6-месячного срока действия требуется только в том случае, если продолжительность работы превышает первоначально выданную продолжительность.

    Первоначальная выдача:

    • Срок действия = Дата начала использования + Продолжительность
    • Срок действия разрешения = Последняя дата истечения срока действия + 6 месяцев

    Поправка после Последней даты истечения срока годности:

    • Срок действия = Дата начала использования + Продолжительность
    • Срок действия разрешения = Дата выдачи + 6 месяцев

    Выдача поправок до Последняя дата истечения срока использования:

    • Срок действия = Дата начала использования + Продолжительность
    • Срок действия разрешения = Последняя дата истечения срока действия + 6 месяцев

    Требования к согласованию проекта и строительства

    Все агентства, выполняющие работы в полосе отвода, запланированные как минимум за шесть месяцев, должны по закону (SMC 15.32.050) вводят информацию о своем проекте в точечные карты (если не исключены критерии, определенные в SMC 15.32.050). Когда проект вводится в dotMaps, генерируется номер плана улучшения улиц и инженерных сетей (SUIP), который необходимо включить в приложения SUUTIL и SUUMP. Более подробную информацию можно найти на веб-странице Координационного бюро проектов и строительства.

    Если ваша работа находится в зоне хаба: После первоначальной выдачи или внесения поправок и до истечения срока действия разрешения любые изменения разрешенных дат использования должны быть согласованы с координатором хаба по электронной почте SDOTConstructionHub @ seattle.губ.

    Если ваша работа находится за пределами зоны концентратора: После первоначальной выдачи или внесения поправок и до истечения срока действия разрешения любые изменения разрешенных дат использования должны быть проверены на соответствие другой запланированной работе в dotMaps до начала работы.

    Ресурсы:

    Памятки по оказанию помощи клиентам (CAM)
    Руководство по улучшениям в Сиэтле (ROWIM)
    Стандартные планы и спецификации Сиэтла
    Рекомендации по проектированию SPU для общественных ливневых дренажных сооружений
    Правила открытия и восстановления полосы отвода ROWORR
    Веб-сайт уличного использования

    К началу страницы

    Пороги для лечения аневризмы брюшной аорты

    Ниже приведены ключевые моменты, о которых следует помнить о пороговых значениях для восстановления аневризмы брюшной аорты в Англии и США:

    1. Решение о том, следует ли восстанавливать аневризму брюшной аорты, требует учета баланса рисков, включая разрыв аневризмы, если операция не проводится. и смерть из-за самого восстановления аневризмы, а также с учетом вероятной продолжительности жизни отдельного пациента.
    2. Диаметр аневризмы — лучший предиктор разрыва аневризмы; риск экспоненциально возрастает с увеличением диаметра. Следовательно, диаметр аневризмы является ключевым фактором, определяющим порог вмешательства.
    3. Международные рекомендации рекомендуют рассматривать возможность вмешательства, если диаметр аневризмы превышает 55 мм у мужчин или 50 мм у женщин.
    4. Однако значительные различия в клинической практике отражают неуверенность в отношении наилучшего порога вмешательства.
    5. Среди пациентов с интактными (неразорвавшимися) аневризмами брюшной аорты скорость восстановления за 8-летний период в Англии была вдвое ниже, чем в США.
    6. Также имелась разница между двумя странами в среднем диаметре аневризмы во время операции с поправкой на 5,3 мм.
    7. Данные национального скрининга в Англии предполагают, что эти два наблюдения могут быть связаны, поскольку распространенность аневризм среднего диаметра для восстановления в США была почти вдвое выше, чем распространенность аневризм среднего диаметра для восстановления в Англии.
    8. Эндоваскулярная пластика использовалась реже в Англии, чем в США, и эндоваскулярная пластика выполнялась при меньшем диаметре аневризмы (в обеих странах), чем открытая пластика.
    9. Среди пациентов, отобранных для лечения аневризмы, внутрибольничная смертность и показатели 3-летней выживаемости были одинаковыми в Англии и США. Это открытие предполагает, что увеличение скорости восстановления аневризмы в Соединенных Штатах не произошло за счет увеличения периоперационного или послеоперационного риска.
    10. Два наблюдения на основе этих данных предполагают, что более низкая скорость восстановления аневризмы в Англии может иметь неблагоприятные последствия. Хотя частота госпитализаций из-за разрыва аневризмы снизилась в обеих странах за 8 изучаемых лет, в Англии этот показатель был более чем в два раза выше, чем в Соединенных Штатах. Кроме того, хотя смертность от аневризмы также снизилась со временем в обеих странах, этот показатель в Англии был в 3,5 раза выше, чем в США.

    Клинические темы: Кардиохирургия, профилактика, сосудистая медицина, хирургия аорты, кардиохирургия и аритмии

    Ключевые слова: Аневризма, разрыв, Аневризма аорты, брюшная, Разрыв аорты, Эндоваскулярные процедуры, Больничная смертность, , Рискованная продолжительность жизни, Ожидаемая продолжительность жизни 61, 905 Неопределенность, Заболевания сосудов


    <Вернуться к списку

    Воздействие повышения уровня моря и прибрежных наводнений

    июль 2020

    Теперь пользователи могут увеличить еще на один уровень в разделах «Повышение уровня моря», «Сценарии» и «Наводнение при приливе».

    Все локации — при моделировании фотографий теперь есть изображения для 7-10 футов.

    График ежегодных событий паводков приливных паводков теперь динамически обновляется и показывает данные до 2019 года.

    Вашингтон — Восточный Пьюджет-Саунд обновлен новыми данными о высоте для NERR залива Падилья и дельты реки Скагит.

    Флорида — обновлено отображение приливной поверхности VDatum.

    Южная Каролина — Отображение новых данных о высотах.Доступна новая матрица высот.

    Луизиана — Отображение новых данных о высотах. Доступна новая матрица высот.

    Техас — переназначен с новыми данными о высоте. Доступна новая матрица высот.

    июль 2019

    Пуэрто-Рико — переназначен с новыми данными о высоте. Доступна новая матрица высот.

    Род-Айленд — переназначен с новыми данными о высоте. Доступна новая матрица высот.

    Массачусетс — переназначен с новыми данными о высоте. Доступна новая матрица высот.

    Нью-Гэмпшир — переназначен с новыми данными о высоте. Доступна новая матрица высот.

    Мэн — переназначен с новыми данными о высоте. Доступна новая матрица высот.

    март 2019

    Коннектикут — переназначен с новыми данными о высоте. Доступна новая матрица высот.

    Пенсильвания — Отображение новых данных о высотах. Доступна новая матрица высот.

    Мэриленд — Северные и западные округа Чесапикского залива переназначены с новыми данными о высоте. Доступны новые ЦМР.

    Вашингтон — Восточные и южные округа Пьюджет-Саунд переназначены с новыми данными о высоте. Доступны новые ЦМР.

    Сентябрь 2018

    Все местоположения — исходные данные о земном покрове обновлены с 2006 по 2010 год.

    Все местоположения — повышение уровня моря, достоверность карт и миграция болот с точностью до 10 футов.

    Гавайи, Гуам, Сайпан, Американское Самоа, Пуэрто-Рико и Виргинские острова США — добавлена ​​карта наводнений при приливе.

    Оаху, Гавайи — переназначен с новыми данными о высоте. Доступна новая матрица высот.

    Гуам — переназначен с новыми данными о высотах. Доступна новая матрица высот.

    Апрель 2017

    Миссисипи — переназначен с новыми данными о высоте.Доступна новая матрица высот.

    Залив Сан-Франциско — обновлено отображение приливной поверхности VDatum.

    Важно — Неопределенность преобразования в региональной модели «Луизиана / Миссисипи — Восточная Луизиана — пролив Миссисипи» составляет от 20 до 50 сантиметров в определенных местах от дельты реки Миссисипи на север до озера Пончартрен. Эти проблемы, скорее всего, можно отнести к проседанию, недавно установленным датамам и изменениям в понимании NAVD88 на основе новых версий GEOID.Команда VDatum в настоящее время занимается решением этих неопределенностей.

    Август 2016

    Северная Южная Каролина, Северная Каролина, Вирджиния, Мэриленд, Делавэр, Нью-Джерси и Нью-Йорк — переназначены с новыми данными о высотах, основанными на данных лидара после Сэнди от USGS и Национальной геодезической службы NOAA. Доступны новые ЦМР.

    2015

    Залив Сан-Франциско, Калифорния — перенесено на карту для исправления выровненных участков.Отображаются дамбы и вымощенные участки.

    Луизиана — нанесено на карту и добавлено для просмотра. Отображаются дамбы и вымощенные участки.

    Виргинские острова США — обновлены данные о высотах на основе лидара 2013 года от NOAA

    Порт-Артур, Техас — переназначен для исправления выровненной площади

    Фрипорт, Техас — переназначен для исправления выровненной площади

    Техас-Сити, Техас — переназначен для исправления выровненной площади

    Граница Мэриленд / Делавэр — изменено отображение, чтобы исправить проблему совпадения краев.

    Граница Северной Каролины / Южной Каролины — переназначен для исправления проблемы совпадения краев

    Палм-Сити, Флорида — исправлена ​​модель рельефа и перенесено на карту

    Реки Чарльз и Мистик недалеко от Бостона, Массачусетс — исправлена ​​модель рельефа и перенесена на карту для исправления защищенной плотиной территории

    Бухта Тилламук, Орегон — Добавлены данные о высоте и перенесено на карту, чтобы заполнить пробел в данных

    Орегон и Техас — Вкладка «Болото» обновлена ​​данными программы анализа изменений прибрежных зон 2010 г. (C-CAP)

    .
    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *